WO2016090001A1 - Deep intronic mutation found adult polyglucosan body disease and uses thereof - Google Patents

Abstract

This invention is directed to a deep intronic mutation in the GBE1 gene, and use of the mutation to efficiently and correctly screen for, identify, and diagnose adult polyglucosan body disease (APBD) in those individuals who are afflicted with or who may develop APBD. The invention also provides primers and probes for this method, as well as targets for basic research for APBD, and the development of preventative and therapeutic agents for APBD.

Description

DEEP INTRONIC MUTATION FOUND ADULT POLYGLUCOSAN BODY DISEASE

AND USES THEREOF

CROSS REFERENCE TO RELATED APPLICATION

The present application claims priority to U.S. patent application serial No. 62/086,476 filed December 2, 2014, which is hereby incorporated by reference in its entirety.

STATEMENT OF GOVERNMENT INTEREST

This invention was made without Government support.

FIELD OF THE INVENTION

This invention relates to the field of screening for, identifying, and diagnosing adult polyglucosan body disease (APBD). Specifically, this invention provides a deep intronic mutation for this disease, and methods of using this mutation to efficiently and accurately diagnose those individuals who are afflicted with or who may develop APBD.

The invention also provides targets for basic research for APBD, and the development of preventative and therapeutic agents for APBD.

BACKGROUND OF THE INVENTION

The synthesis of glycogen is catalyzed by the sequential actions of two enzymes: glycogen synthase; and the glycogen branching enzyme. Glycogen storage disease type IV (GSD IV) is an autosomal recessive disorder caused by glycogen branching enzyme (GBE) deficiency. One form of GSD, adult polyglucosan-body disease (APBD) is characterized by onset after age 50 of progressive pyramidal paraparesis, distal sensory deficits, neurogenic bladder, ambulation loss, and premature death due to complications of myelopathy and peripheral neuropathy (Klein (2009); Mochel et al. (2012)). The disease is in the differential diagnoses of multiple sclerosis (MS) and amyotrophic lateral sclerosis (ALS), separated from MS by late-onset, progressive symmetric course and peripheral neuropathy, from ALS by sensory deficits, incontinence and florid subcortical and spinal cord changes on MRI, and from both by autosomal recessive inheritance (Mochel et al. (2012)). The neuropathological hallmark of APBD, like all GSDs, are polyglucosan bodies (PB), which are accumulations of aggregated, poorly branched insoluble glycogen in the central nervous system (CNS) and peripheral nervous system (PNS). In neurons, PBs are principally in axons, often appearing to fill the axons. Other features include CNS demyelination and gliosis, and loss of PNS myelinated fibers (Paradas et al. (2014); Ubogu et al. (2005)). There is no current treatment available for APBD or any glycogenosis type IV disease.

APBD is allelic to glycogenosis type IV (GSD-IV) (MIM 232500). Classical GSD-IV patients have profound GBE deficiency and die in childhood of liver failure with massive hepatic and extrahepatic polyglucosan accumulations. Individuals with complete deficiency usually die prenatally (Andersen (1956)).

Most APBD patients are of Ashkenazi Jewish descent, and 70% are homozygous for the NM_000158:c.986A>C/p.Y329S GBEl mutation. There are no known Ashkenazi Jewish APBD patients who do not carry at least one copy of the p.Y329S mutation. About 30% are compound heterozygotes of p.Y329S, very few are with p.L224P. As expected, carrier parents are unaffected (Klein (2009)).

Until now, it was believed that a surprisingly large fraction of patients, about 30%, carry the p.Y329S mutation in heterozygous state with no other mutation in the 16 exons of the gene (Mochel et al. (2012)). However, as shown herein, it was discovered that these so-called "manifesting heterozygotes" actually harbor a second deep intronic mutation on the so-called normal allele. This discovery not only highlights the need for better methods of diagnosing populations of APBD patients to understand the full extent of the mutations with the goal of eventually designing an appropriate therapy but also provides a means for achieving these goals.

SUMMARY OF THE INVENTION

The current invention is based on the surprising discovery of so-called "manifesting heterozygotes" of APBD actually harbor a second deep intronic mutation on the so-called normal allele. This second mutation, referred to herein as the "GBEl -deep intronic mutation", is found in intron 15 at nucleotide 5298 of the GBEl gene and replaces a nine nucleotide sequence (GTGTGGTGG) with a 19 nucleotide sequence (TGTTTTTTACATGACAGGT) (SEQ ID NO: 1). The new second mutation was present in the GBEl gene of all manifesting heterozygotes having APBD, but did not occur in APBD patients with homozygous GBE1 NM_000158:c.986A>C/p.Y329S.

Thus, the current invention is a method for the detection, identification, and diagnosis of APBD. Because APBD can be confused with other neurological disorders, such as MS and ALS, a proper diagnosis is key. Also because the current invention provides an accurate diagnosis of APBD often before symptoms occur, it allows early intervention which may improve both length and quality of life for patients. This method for detection, identification, and diagnosis of APBD can be performed on adults, both pregnant and non-pregnant, children, human embryos and fetuses and unborn human children.

More specifically, one embodiment of the present invention is a method for detecting the presence of the GBE1 -deep intronic mutation in the GBE1 gene, wherein the presence of the GBE1 -deep intronic mutation specific to APBD in the GBE1 gene in a sample from a subject is an indication that the subject is afflicted with or will develop APBD. The current invention provides a method to detect APBD that is highly specific, and highly sensitive, by identifying the GBE1 -deep intronic mutation, even prior to any symptoms of the disease. The invention also provides a simple, accurate, and high-throughput method using the GBE1 -deep intronic mutation as well as a kit. The invention also provides a method for APBD detection which can be easily automated using blood samples as measuring targets.

Suitable methods for determining the sequence of the mutation include: DNA sequencing; restriction fragment length polymorphism (RFLP) analysis; hybridization with allele- specific oligonucleotides; HOT cleavage; denaturing gradient gel electrophoresis; temperature denaturing gradient gel electrophoresis; single stranded conformational polymorphisms; denaturing high performance liquid chromatography; polymerase chain reaction (PCR) including allele-specific PCPv, TaqMan PCR, real-time PCR (RT-PCR), and PCR with mass spectrometry; oligonucleotide microarray analysis including microarray-based assay; 5' nuclease digestion; molecular beacon assay; oligonucleotide ligation assay; size analysis; nucleic acid sequencing; and combinations thereof. Nucleic acids include genomic DNA, cDNA or mRNA.

One preferred method for detection of the GBE1 -deep intronic mutation in the GBE1 gene is:

a. isolating DNA from the sample of the subject;

b. amplifying the GBE1 -deep intronic mutation using the PCR method; and c. determining the presence of the GBE1 -deep intronic mutation in the GBE1 gene in the sample from the subject, which indicates that the subject is afflicted with or at risk of developing APBD.

Preferred embodiments include using a fluorescent probe in step (b) such as in real-time PCR. Determination of the presence of the GBE1 -deep intronic mutation in step (c) can be performed by mass spectrometry or sequencing.

A further preferred embodiment of the method comprises:

a. isolating DNA or mRNA from the sample of the subject;

b. generating cDNA from the mRNA;

c. amplifying the GBE1 -deep intronic mutation using the PCR method; and

d. determining the presence of the GBE1 -deep intronic mutation in the GBE1 gene in the sample from the subject, which indicates that the subject is afflicted with or at risk of developing APBD.

In another embodiment, in addition to determining the presence of the GBE1 -deep intronic mutation, the method provides determining if the nucleic acid comprises a p.Y329S mutation, and further comprises:

d. amplifying the p.Y329S mutation using the PCR method; and

e. determining the presence of the p.Y329S mutation in the GBE1 gene in the sample from the subject, which further indicates and confirms that the subject is afflicted with APBD or at risk for developing APBD.

A further embodiment of the present invention is method for detection of the GBE1 -deep intronic mutation in the GBE-1 gene comprising:

a. isolating DNA from the sample of the subject;

b. contacting the DNA with a microarray comprising oligonucleotides; and

c. determining the presence of the GBE1 -deep intronic mutation in the GBE1 gene in the sample from the patient, which indicates that the patient is afflicted with or at risk of developing APBD.

In certain aspects the microarray comprises a plurality of oligonucleotides which are complementary to SEQ ID NO: 1. In certain aspects, the microarray comprises a plurality of oligonucleotides which are complementary to the flanking sequences of SEQ ID NO: 1 in the GBE1 gene. In certain aspects the oligonucleotides comprise at least one synthetic nucleic acid sequence selected from the group consisting of synthetic nucleic acids described herein.

In a further embodiment the microarray further comprises a plurality of oligonucleotides which are complementary to the Y.329S mutation.

In certain aspects, the invention relates to a synthetic nucleic acid comprising at least about 10 nucleotides of an isolated (or non-isolated) nucleic acid having the sequence of SEQ ID NO: 1 ; an isolated (or non-isolated) nucleic acid complementary to the sequence of SEQ ID NO: 1; an isolated (or non-isolated) nucleic acid having at least about 60% sequence identity to any SEQ ID NO: 1; an isolated (or non-isolated) nucleic acid having at least about 60% sequence identity to a nucleic acid complementary to the sequence of SEQ ID NO: 1 ; an isolated (or nonisolated) nucleic acid which comprises at least 10 consecutive nucleotides of SEQ ID NO: 1; an isolated (or non-isolated) nucleic acid which comprises at least 10 consecutive nucleotides of a nucleic acid complementary to the sequence of SEQ ID NO: 1; an isolated (or non-isolated) nucleic acid which comprises at least 10 consecutive nucleotides of a sequence having at least about 60% identity to SEQ ID NOs: 1; or an isolated (or non-isolated) nucleic acid which comprises at least 10 consecutive nucleotides of a sequence having at least about 60% identity to a nucleic acid complementary to the sequence of SEQ ID NO: 1.

In certain aspects, the invention relates to a primer set for determining the presence or absence of the GBE1 -deep intronic mutation in a sample, wherein the primer set comprises at least one synthetic nucleic acid sequence selected from the group consisting of synthetic nucleic acids described herein.

In certain aspects, the synthetic nucleic acids described herein can be used for probes as well as oligonucleotides that can be used for anti-sense oligonucleotides for the prevention and treatment of APBD.

A further embodiment of the present invention is a method as outlined above wherein at least either nucleotide sequence of a pair of PCR primers is complementary to a nucleotide sequence in the DNA on a region containing the GBE1 -deep intronic mutation and can specifically hybridize to said nucleotide sequence in the DNA when said GBE1 -deep intronic mutation is present.

The invention is also directed to the use of a primer for detecting the presence of the GBE1- deep intronic mutation specific for APBD in a sample from a patient. A further embodiment of the current invention is a kit to be used for any of the methods for detecting the GBE1 -deep intronic mutation, said kit can include at least one of primers as described above and a microarray as described above, and in certain embodiments, the kit can include both components.

A further embodiment of the current invention is a mouse model for APBD, produced by introducing the GBE1 -deep intronic mutation into a mouse.

Further embodiments of the current invention are compositions and methods for basic research regarding APBD as well as for the testing and development of an agent for the prevention and/or treatment of APBD.

BRIEF DESCRIPTION OF THE FIGURES

For the purpose of illustrating the invention, there are depicted in drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Figures 1A and IB show that mRNA from the allele with the unknown mutation in manifesting heterozygotes does not contain exon 16. Figure 1A shows an example electropherogram from a PCR product of GBE1 genomic DNA in manifesting heterozygotes that was heterozygous for the c.986A>C mutation. Figure IB shows example electropherograms of cDNA from a manifesting heterozygote amplified with primers in exons 6 (forward) and 15 (reverse) (left panel) and with primers in exons 6 (forward) and 16 (reverse) (right panel). Horizontal arrows above the electropherograms indicate exon boundaries within the segments of cDNA sequence shown. The gels beneath the electropherograms show example PCR products which have the indicated sequences.

Figures 2A, 2B, and 2C show evidence of the deletion/insertion in genomic DNA of manifesting heterozygote patients inserts a pseudo exon that encodes an unstable protein. Figure 2A are electropherograms from a manifesting heterozygote ("patient") and a healthy control ("control"). The deletion/insertion sequence (above the electropherograms) was resolved by subtracting control from patient sequence. Figure 2B show electropherograms from manifesting heterozygotes. Figure 2C is a leukocyte Western blot of GBE protein in manifesting heterozygous patients compared with p.Y329S homozygous cases using 30 μg protein and a polyclonal GBE antibody raised against a synthetic peptide from the central region of human GBE.

Figure 3A illustrates the complementary DNA to the allele with p.Y329S mutation and the location of primers that can amplify the region for the test of p.Y329S mutation and also shows the allele with the second mutation in intron 15. Figure 3B shows a diagram of GBE1- deep intronic mutation.

Figure 4 is a diagram illustrating the construction of the targeting vector to produce a knock-in mouse with the GBE1 -deep intronic mutation versus normal mRNA.

Figure 5 is a diagram illustrating the desired homologous recombination of the targeting vector into ES cells.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

The terms used in this specification generally have their ordinary meanings in the art, within the context of this invention and the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the methods of the invention and how to use them. Moreover, it will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of the other synonyms. The use of examples anywhere in the specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the invention or any exemplified term. Likewise, the invention is not limited to its preferred embodiments.

In accordance with the present invention, there may be numerous tools and techniques within the skill of the art, such as those commonly used in molecular immunology, cellular immunology, pharmacology, and microbiology. See, e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology, John Wiley and Sons, Inc.: Hoboken, N.J.; Bonifacino et al. eds. (2005) Current Protocols in Cell Biology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, N.J.; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, N.J.

As used herein, the term "allele" means a particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence, or one of the alternative polymorphisms found at a polymorphic site.

As used herein, the term "genotype" means the genetic makeup of a cell, an organism, or an individual {i.e. the specific allele makeup of the individual) usually with reference to a specific character under consideration.

As used herein, the term "haplotype" means a combination of alleles (DNA sequences) at adjacent locations (loci) on the chromosome that are transmitted together. A haplotype may be one locus, several loci, or an entire chromosome depending on the number of recombination events that have occurred between a given set of loci.

As used herein, the term "linkage" means the association of two or more loci at positions on the same chromosome, such that recombination between the two loci is reduced to a proportion significantly less than 50%. The term linkage can also be used in reference to the association between one or more loci and a trait if an allele (or alleles) and the trait, or absence thereof, are observed together in significantly greater than 50% of occurrences. A linkage group is a set of loci, in which all members are linked either directly or indirectly to all other members of the set.

As used herein, "linkage disequilibrium (LD)" is a co-occurrence of two genetic loci {e.g., markers) at a frequency greater than expected for independent loci based on the allele frequencies. Linkage disequilibrium (LD) typically occurs when two loci are located close together on the same chromosome. When alleles of two genetic loci (such as a marker locus and a causal locus) are in strong LD, the allele observed at one locus (such as a marker locus) is predictive of the allele found at the other locus (for example, a causal locus contributing to a phenotypic trait). As used herein, the term "locus" means a location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature, where physical features include polymorphic sites.

As used herein, the term "mutation" means any change of a nucleic acid sequence as a source of genetic variation.

Adult polyglucosan body disease or APBD will be used interchangeably and is a glycogen storage disease characterized by a constellation of progressive and debilitating symptoms, including progressive pyramidal paraparesis, distal sensory deficits, neurogenic bladder, ambulation loss, and premature death due to complications of myelopathy and peripheral neuropathy.

As used herein, the term "GBEl gene" means the gene encoding 1,4-alpha-glucan- branching enzyme, also known as a brancher enzyme or glycogen-branching enzyme. The sequences for the GBEl gene and the GBEl protein amino acid sequence are referenced below.

The terms "NM_000158:c.986A>C/p.Y329S", "c.986A>C mutation" and "p.Y329S" will be used interchangeably and refer to the mutation on one allele of patients afflicted with APBD.

As used herein, the term "manifesting heterozygote" means patients heterozygous for the NM_000158:c.986A>C/p.Y329S or the exon 7 c.986A>C mutation (p.Y329S) in gDNA. A subject that is heterozygous for what is ordinarily a recessive condition that, as a result of special mechanisms (such as lyonization, allelic exclusion, or a deletion in the homologous chromosome), has phenotypic manifestations.

The term "GBEl -deep intronic mutation" as used herein refers to the mutation found on the second so-called "normal" allele in patients afflicted with APBD. This mutation is found in intron 15 at nucleotide 5298 of the GBEl gene and replaces a nine nucleotide sequence (GTGTGGTGG) with a 19 nucleotide sequence (TGTTTTTTACATGACAGGT) (SEQ ID NO: 1) or in short-hand, IVS15+5289_5297 del GTGTGGTGG ins TGTTTTTTACATGACAGGT (SEQ ID NO.: 1).

As used herein, the term "polyglucosan bodies (PB)" means accumulations of aggregated, poorly branched insoluble glycogen in the central nervous system (CNS) and peripheral nervous system (PNS), which are the neuropathological hallmark of APBD. In neurons, PB are principally in axons, often appearing to fill the axons. As used herein, the term "founder mutation" means a mutation that appears with high frequency in the DNA of one or more individuals who are founders of a group such as individuals having APBD. The founder gene mutation typically occurs in a group that is or was geographically or culturally isolated, in which one or more of the ancestors was a carrier of the mutant gene. Founder mutations originate in long stretches of DNA on a single chromosome— indeed, the original haplotype is the whole chromosome. As the generations progress, the proportion of the haplotype that is common to all carriers of the mutation is shortened (due to genetic recombination).

As used herein, the term "sample" means a biological sample obtained from a subject. For embodiments of the present invention, a blood sample such as whole blood or serum, or saliva is preferred. However other biological samples include cells, tissues, biopsied or surgically removed biological tissue, urine, sputum, cerebrospinal fluid, amniotic fluid, or bone marrow aspirates.

As used herein, the term "subject" means any organism including, without limitation, a mammal such as a mouse, a rat, a dog, a guinea pig, a ferret, a rabbit and a primate. In the preferred embodiment, the subject is a human being.

The term "patient" as used in this application means a human subject. In some embodiments of the present invention, the "patient" is one suffering adult polyglucosan body disease or APBD, or suspected of suffering from APBD.

The terms "screen" and "screening" and the like as used herein means to test a subject or patient to determine if they have a particular illness or disease, in this case APBD. The term also means to test an agent to determine if it has a particular action or efficacy.

The terms "diagnosis", "diagnose", diagnosing" and the like as used herein means to determine what physical disease or illness a subject or patient has, in this case APBD.

The terms "identification", "identify", "identifying" and the like as used herein means to recognize a disease in a subject or patient, in this case APBD. The term also means to recognize an agent as being effective for a particular use.

The terms "treat", "treatment", and the like refer to a means to slow down, relieve, ameliorate or alleviate at least one of the symptoms of the disease, or reverse the disease after its onset. The terms "prevent", "prevention", and the like refer to acting prior to overt disease onset, to prevent the disease from developing or minimize the extent of the disease or slow its course of development.

The term "agent" as used herein means a substance that produces or is capable of producing an effect and would include, but is not limited to, chemicals, pharmaceuticals, biologies, small organic molecules, antibodies, nucleic acids, peptides, and proteins.

The term "antisense DNA" is the non-coding strand complementary to the coding strand in double-stranded DNA.

The term "genomic DNA" as used herein means all DNA from a subject including coding and non-coding DNA, and DNA contained in introns and exons.

The term "cDNA" as used herein means coding DNA and includes only exons.

As used herein, the term "isolated" and the like means that the referenced material is free of components found in the natural environment in which the material is normally found. In particular, isolated biological material is free of cellular components. In the case of nucleic acid molecules, an isolated nucleic acid includes a PCR product, an isolated mRNA, a cDNA, an isolated genomic DNA, or a restriction fragment. In another embodiment, an isolated nucleic acid is preferably excised from the chromosome in which it may be found. Isolated nucleic acid molecules can be inserted into plasmids, cosmids, artificial chromosomes, and the like. Thus, in a specific embodiment, a recombinant nucleic acid is an isolated nucleic acid. An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein. An isolated material may be, but need not be, purified.

The term "purified" and the like as used herein refers to material that has been isolated under conditions that reduce or eliminate unrelated materials, i.e., contaminants. For example, a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell; a purified nucleic acid molecule is preferably substantially free of proteins or other unrelated nucleic acid molecules with which it can be found within a cell. As used herein, the term "substantially free" is used operationally, in the context of analytical testing of the material. Preferably, purified material substantially free of contaminants is at least 50% pure; more preferably, at least 90% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.

The term "nucleic acid hybridization" refers to anti-parallel hydrogen bonding between two single-stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are "hybridizable" to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the complementary bases of another nucleic acid molecule under defined stringency conditions. Stringency of hybridization is determined, e.g., by (i) the temperature at which hybridization and/or washing is performed, and (ii) the ionic strength and (iii) concentration of denaturants such as formamide of the hybridization and washing solutions, as well as other parameters. Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under "low stringency" conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid). Hybridization conditions for various stringencie are known in the art and are disclosed in detail in at least Sambrook et al.

The terms "vector", "cloning vector" and "expression vector" mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors include, but are not limited to, plasmids, phages, and viruses.

Vectors typically comprise the DNA of a transmissible agent, into which foreign DNA is inserted. A common way to insert one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. A "cassette" refers to a DNA coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. Generally, foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA. A segment or sequence of DNA having inserted or added DNA, such as an expression vector, can also be called a "DNA construct" or "gene construct." A common type of vector is a "plasmid", which generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can readily introduced into a suitable host cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA. Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular protein or enzyme. Promoter DNA is a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA. Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. A large number of vectors, including plasmid and fungal vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmids (Clonetech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, WI), pRSET or pREP plasmids (Invitrogen, San Diego, CA), or pMAL plasmids (New England Biolabs, Beverly, MA), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art. Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes.

The term "host cell" means any cell of any organism that is selected, modified, transformed, grown, used or manipulated in any way, for the production of a substance by the cell, for example, the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme. Host cells can further be used for screening or other assays, as described herein.

A "polynucleotide" or "nucleotide sequence" is a series of nucleotide bases (also called "nucleotides") in a nucleic acid, such as DNA and RNA, and means any chain of two or more nucleotides. A nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide. This includes single- and double- stranded molecules, i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as "protein nucleic acids" (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases, for example thio-uracil, thio-guanine and fluoro-uracil.

The nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non- coding regions, and the like. The nucleic acids may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, and carbamates) and with charged linkages (e.g., phosphorothioates, and phosphorodithioates). Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, and poly-L-lysine), intercalators (e.g., acridine, and psoralen), chelators (e.g., metals, radioactive metals, iron, and oxidative metals), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Furthermore, the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.

The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system, i.e., the degree of precision required for a particular purpose, such as a pharmaceutical formulation. For example, "about" can mean within 1 or more than 1 standard deviations, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5 -fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term "about" meaning within an acceptable error range for the particular value should be assumed. Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. GRE -Deep Intronic Mutation found in Manifesting Heterozygotes of APBD

APBD is allelic to glycogenosis IV (GSD-IV) (MIM 232500). Classical GSD-IV patients have profound GBE deficiency and die in childhood of liver failure with massive hepatic and extrahepatic polyglucosan body (PB) accumulations. Cases with complete deficiency usually die prenatally. APBD patients have approximately 18% GBE activity and smaller PB. Their livers and other non-nervous tissues, though containing PBs, remain clinically spared (Lossos et al. (1991); Lossos et al. (1998)).

As discussed above, there are about 30% of Ashkenazi APBD patients who appeared to have a manifesting heterozygous genotype, meaning that it appeared that these patients had one mutated allele (p.Y329S) and one normal allele.

It was expected that the heterozygous subjects would have the same level of GBEl expression as the homozygous subjects. However, all 16 manifesting heterozygous patients unexpectedly had glycogen branching activity of 8% compared to homozygous patients with 18% enzyme activity, showing inactivation of the apparently normal allele. The mRNA structure was studied and it was discovered that there was a genetic change due to a second mutation.

In a cohort of 35 APBD patients, 16 were homozygous and 19 heterozygous for the well- known p.Y329S mutation in exon 7. This mutation segregated with two haplotypes, and three heterozygous patients harbored a third haplotype associated with a second missense exonic mutation, p.L224P. However, in the remaining 16 heterozygous patients for the p.Y329S mutation, extensive searches, including exonic and cDNA sequencing, multiplex ligation- dependent probe amplification, and whole-genome sequencing, failed to reveal a second mutation. The possibility arose that in these patients p.Y329S, alone on one allele, was somehow sufficient to cause the disease, i.e. that these cases were "manifesting heterozygotes". However, haplotype analysis showed that all these patients shared a common haplotype, separate from their p.Y329S-associated haplotypes, suggesting that they actually did harbor a second mutation that was not detected despite whole-genome sequencing.

It was shown by the inventors that these manifesting heterozygous Ashkenazi APBD patients actually were compound heterozygous for two mutations: the known mutation p.Y329S and a newly discovered second mutation, herein referred to as the "GBEl -deep intronic mutation" which is:

IVS15+5289_5297 del GTGTGGTGG ins TGTTTTTTACATGACAGGT (SEQ ID NO.: 1). The new second mutation was present in the GBEl gene of all manifesting heterozygotes having APBD, but did not occur in homozygous GBEl p.Y329S patients. This new mutation resulted in a p.Y329S mutant mRNA and complete lack of mRNA encoded by the new (second) allele having the GBEl -deep intronic mutation. This mutation acts as a gene-trap by creating a pseudo last-exon so that the mRNA transcript from this allele misses ex on 16 and the 3'UTR, thereby encoding an abnormal GBE1 mRNA and an unstable, truncated enzyme that is degraded. This results in the further decreasing enzyme activity from 18% seen in homozygous APBD patients to 8% in the manifesting heterozygotes with the GBE1 -deep intronic mutation. The GBE1 -deep intronic mutation is the second most common APBD mutation, and it explains another founder effect in all Ashkenazi Jewish cases.

In molecular biology, to study a mutation or genetic change requires PCR amplification of the DNA. DNA amplification is only possible by primers located on both sides of the area of interest. As shown in Figure 3A, the arrows in the figure top panel illustrates the complementary DNA with p.Y329S mutation and the location of primers that can amplify the region for the test of p.Y329S mutation. However, as shown the bottom panel, the second mutation changes the ex on 16 sequence. Because the sequence (indicated by the question mark) was not known there was no way to prime the sequence (arrow) preventing amplification of the region by PCR.

While the GBE1 -deep intronic mutation identified here is not the first intronic mutation causing neurological disease, it is unusual because of its location in the last intron. The discovery of this mutation was complicated because there was no exon beyond the mutation on which to place a primer and amplify the aberrant transcript. However, because premature termination involving last exons do not cause nonsense-mediated mRNA decay (Neu-Yilik et al. (2011)) and the aberrant transcript was present, it was eventually specifically amplifiable.

Whole-genome sequencing shears gDNA, sequences billions of fragments, and bioinformatically reassembles their sequences into a genome. Output files catalogue the millions of variants, as well as innumerable regions where the program fails, usually in non-coding regions where DNA is repetitive, to generate correct re-assembly (Alkan et al. (2011)). The GBE1 -deep intronic mutation is in such a region, which highlights present-day shortfalls of whole-genome sequencing even when the mutation in a known locus, i.e. in a known single gene, that could not be detected. Obviously other such mutations are missed.

The discovery of the GBE1 -deep intronic mutation enables methods for a specific diagnosis in the vast majority of at least Ashkenazi Jewish APBD patients, and precise genetic and prenatal diagnosis and counseling. It also provides a target for drug screening, screening for other therapeutics and preventative agents, and basic research on APBD and other genetic diseases. Methods for the Detection of the GBE1 -Deep Intronic Mutation and Diagnosis and Identification of APBD

The discovery of the GBEl-deep intronic mutation, together with the known p.Y329S mutation, allows specific diagnosis in the vast majority of at least Ashkenazi APBD patients, and precise genetic and prenatal diagnosis and counseling. Certain embodiments are directed to methods for diagnosing APBD in a subject by determining if the subject has the GBE1 -deep intronic mutation, either alone or together with the p.Y329S mutation. If the mutation is detected, the subject is either treated or monitored for early intervention if symptom-free,.

Certain embodiments are directed to a method comprising: (a) obtaining a sample comprising a nucleic acid encoding GBE1 from a subject; (b) determining if the nucleic acid comprises a GBE1 -deep intronic mutation comprising SEQ ID NO. 1; and (c) if the GBE1 -deep intronic mutation is detected, then determining that the subject has APBD or is at risk of developing APBD and optionally, if the subject has APBD, then treating the subject, if the subject is at risk of developing APBD, then monitoring the subject to facilitate early intervention.

The sample is not limited as far as it is obtained from subjects and patients, and include blood, blood cells, lymph, buccal cells, epithelial cells, fibroblasts, cells present in any biological tissue obtained by biopsy, hair, nails, sputum, saliva, mucosal scraping, amniotic fluid or tissue biopsy.

Subjects and patients are not limited as well, as far as they are human. The subject can be a non-pregnant adult, a pregnant female adult, a child, a human embryo, a human fetus or an unborn human child. The present invention is preferably applied to high risk patients for APBD, those with a family history of the disease or other GSD, or of Ashkenazi Jewish descent.

According to the present invention, it is necessary to extract the nucleic acid from the samples. The nucleic acid is extracted, isolated and purified from the samples by methods known in the art.

In some embodiments the GBE1 -deep intronic mutation is detected using the following methods: DNA sequencing; polymerase chain reaction (PCR) including allele-specific PCR, TaqMan PCR, real-time PCR (RT-PCR), and PCR with mass spectrometry; oligonucleotide microarray analysis including microarray-based assay; allele-specific hybridization; 5' nuclease digestion; molecular beacon assay; oligonucleotide ligation assay; size analysis; nucleic acid sequencing; and combinations thereof. Nucleic acids include genomic DNA, cDNA or mRNA. In some embodiments, the method comprises the nucleic acid in the sample being amplified using oligonucleotide primers such as those described herein that are specific for the GBE1 -deep intronic mutation or that are capable of amplifying a region containing the mutation.

A preferred embodiment of the present invention is a method utilizing polymerase chain reaction or PCR. PCR means a method according to the invention wherein at least either nucleotide of a pair of PCR primers is complementary to a nucleotide sequence in the genomic DNA on a region containing the GBEl-de&p intronic mutation (SEQ ID NO: 1), and can specifically hybridize to said nucleotide sequence in the DNA when the GBE1 -deep intronic mutation is present. In particular, when the GBE1 -deep intronic mutation is present, PCR amplification with PCR primers which can specifically hybridize to the nucleotide sequences containing the GBE1 -deep intronic mutation is carried out, and the absence or presence of the GBE1 -deep intronic mutation is detected depending on the absence or presence of amplification products.

One particular method is the use of oligonucleotide primers to discriminate between target DNA sequences that differ by a single nucleotide in the region of interest called allele- specific PCR. These allele-specific primers will anneal only to the alleles of interest. In this case, the primers of the current invention made from the nucleotide sequence of the GBE1 -deep intronic mutation (SEQ ID NO: 1) can be used as a screen of the genomic DNA from the subject. Only if the DNA contains the GBE1 -deep intronic mutation will the primers anneal and amplify the product.

Mutation detection using the 5'→ 3' exonuclease activity of Taq DNA polymerase (TaqMan™ assay) can also be used as a screening and diagnostic method of the current invention. Such an assay involves hybridization of three primers, the third primer being intended to bind just downstream of one of the conventional primers which should be allele-specific. The additional primer carries a blocking group at the 3' terminal nucleotide so that it cannot prime new DNA synthesis and at its 5' end carries a labeled group. In modern versions of the assay, the label is a fluorogenic group and the third primer also carries a quencher group. If the upstream primer which is bound to the same strand is able to prime successfully, Taq DNA polymerase will extend a new DNA strand until it encounters the third primer in which case its 5'→ 3' exonuclease will degrade the primer causing release of separate nucleotides containing the dye and the quencher, and an observable increase in fluorescence. PCR with mass spectrometry uses mass spectrometry to detect the end amplification product. Sequencing can also be used to detect the amplification product.

Length of said amplified products can be normally below 1000 bp, preferably below 180 bp, and most preferably below about 100 bp.

A further preferred method for detection the GBEl -deep intronic mutation is microarray analysis utilizing a microarray-based assay. This method is performed by contacting DNA from a subject with a microarray-based assay comprising a plurality of nucleic acid probes wherein each probe comprises a nucleic acid that is complementary to SEQ ID NO: 1 or sequences flanking the GBEl -deep intronic mutation on the GBEl gene (e.g., SEQ ID NOs: 27 and 28), and can specifically bind to the DNA when the GBEl -deep intronic mutation is present. The absence or presence of the GBEl -deep intronic mutation is detected depending on the absence or presence of hybridization products.

In a preferred embodiment, the microarray-based assay comprises at least 2 nucleic acid probes, in a more preferred embodiment, at least 5 nucleic acid probes, in a more preferred embodiment, at least 10 nucleic acid probes, in a more preferred embodiment, at least 15 nucleic acid probes, in a more preferred embodiment, at least 25 nucleic acid probes, and in a most preferred embodiment, at least 50 nucleic acid probes, said nucleic acid probes comprising a nucleic acid that is complementary to SEQ ID NO: 1 or sequences flanking and/or surrounding the GBEl -deep intronic mutation on the GBEl gene.

A variety of different array formats are known in the art, with a variety of different probe structures, substrate compositions, and attachment technologies.

All of these methods can additionally include steps to further determine if the DNA contains the Y.329S mutation. This is accomplished by the additional amplification of the DNA with primers for the Y.329S mutation and/or additional probes complementary to the Y.329S mutation.

Probes and Primers

In other aspects the invention is directed to isolated nucleic acid sequences such as primers and probes, comprising nucleic acid sequence of SEQ ID NO: 1. Such primers and/or probes may be useful for detecting the presence of the GBEl -deep intronic mutation. The isolated nucleic acids which can be used as primer and probes are of sufficient length to allow hybridization with, i.e. formation of duplex with a corresponding target nucleic acid sequence, a nucleic acid sequences of SEQ ID NO: 1, or a variant thereof.

The isolated nucleic acid of the invention which can be used as primers and/or probes can comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more consecutive nucleotides from SEQ ID NO: 1, or sequences complementary to SEQ ID NO: 1, or sequences having at least about 60% sequence identity to SEQ ID NO: 1, or sequences having at least about 60% sequence identity to sequences complementary to SEQ ID NO: 1. The invention is also directed to primers and/or probes which can be labeled by any suitable molecule and/or label known in the art, for example but not limited to fluorescent tags suitable for use in Real Time PCR amplification, for example TaqMan, cybergreen, TAMRA and/or FAM probes; radiolabels, and so forth. In certain embodiments, the oligonucleotide primers and/or probe further comprises a detectable non-isotopic label selected from the group consisting of: a fluorescent molecule, a chemiluminescent molecule, an enzyme, a cofactor, an enzyme substrate, and a hapten.

In certain aspects, the invention is directed to primer sets comprising isolated nucleic acids as described herein, which primer sets are suitable for amplification of nucleic acids from samples which may contain the GBE1 -deep intronic mutation represented by SEQ ID NO: 1, or variants thereof. Primer sets can comprise any suitable combination of primers which would allow amplification of a target nucleic acid sequences in a sample which may contain the GBE1- deep intronic mutation, represented by SEQ ID NO: 1, or variants thereof.

While primers can be designed by those of skill in the art using the nucleotide sequence of the GBE1 -deep intronic mutation (SEQ ID NO: 1) and the surrounding sequences of the GBE1 gene, the following are preferred primer pairs for use in the current method.

For use for cDNA amplification and analysis:

GBEl-Ex6F (SEQ ID NO: 11) and GBEl-Exl6R (SEQ ID NO: 19);

GBEl-Ex6F (SEQ ID NO: 11) and NEW3'UTR-R (SEQ ID NO: 25);

GBEl-Exl3F (SEQ ID NO: 20) and oligo dT primer; and

GBEl-Exl4F (SEQ ID NO: 21) and oligo dT primer, optionally sequenced with a third primer, GBEl-Exl5F (SEQ ID NO: 22).

For use for genomic DNA amplification and analysis:

hGBEl-Ex7F (SEQ ID NO: 6) and hGBEl-Ex7R (SEQ ID NO: 7);

hGBEl-Ex7F (SEQ ID NO: 6) and NEW3'UTR-R (SEQ ID NO: 25); and GBEl-Intl5F (SEQ ID NO: 9) and GBEl-Intl5R7 (SEQ ID NO: 10).

The use of GBEl-Intl5F (SEQ ID NO: 9) and GBEl-Intl5R7 (SEQ ID NO: 10) primers is most preferred when genomic DNA is used.

Primers for the additional detection of the p.Y329S mutation can also be designed by those of skill in the art using known sequences. The following preferred primer pairs can be used for in the current method:

GBEl-Ex6F (SEQ ID NO 11) and GBEl-Ex8R (SEQ ID NO: 12);

GBEl-Ex6F (SEQ ID NO 11) and GBEl-ExlOR (SEQ ID NO 13)

GBEl-Ex6F (SEQ ID NO 11) and GBEl-Exl lR (SEQ ID NO 14)

GBEl-Ex6F (SEQ ID NO 11) and GBEl-Exl2R (SEQ ID NO 15)

GBEl-Ex6F (SEQ ID NO 11) and GBEl-Exl3R (SEQ ID NO 16)

GBEl-Ex6F (SEQ ID NO 11) and GBEl-Exl4R (SEQ ID NO 17)

GBEl-Ex6F (SEQ ID NO 11) and GBEl-Exl5R (SEQ ID NO 18).

One of skill in the art would understand that some bases can be deleted from or added to the end of SEQ ID NOs: 6, 7, 9-22, and 25 and said primers can still amplify the mutation of interest. Accordingly, this invention includes primers wherein some bases are deleted or added to sequences of SEQ ID NOs: 6, 7, 9-22, and 25.

In certain aspects, the invention is directed to oligonucleotide probes comprising isolated nucleic acids as described herein, which probes are suitable for hybridization to nucleic acids from samples which may contain the GBE1 -deep intronic mutation represented by SEQ ID NO: 1, or variants thereof. Probe can be designed by those of skill in the art using the nucleotide sequence of the GBEl-deep intronic mutation (SEQ ID NO: 1) and the surrounding/ flanking sequences of the GBE1 -deep intronic mutation (SEQ ID NO: 1) in GBE1 gene.

Probes preferably comprise from about 10 to 50 nucleotides, wherein at least about 10 contiguous nucleotides are at least 95% complementary to a nucleic acid target region within SEQ ID NO: 1 or flanking a nucleic acid comprising SEQ ID NO: 1.

Kits and Systems

Also provided are reagents and kits for practicing one or more of the above-described methods. The subject reagents and kits thereof may vary greatly. Reagents of interest include reagents specifically designed for use in determining if a subject has the GBE1 -deep intronic mutation, and additionally if desired, the Y.329S mutation. In some embodiments oligonucleotides are adapted for use in an in situ hybridization format for detecting and identifying mutations or for use in a microarray.

One type of regent that is specifically tailored for the detection of the GBEl -deep intronic mutation is at least one oligonucleotide primer specific for the GBEl -deep intronic mutation identified by SEQ ID NO: 1 to amplify nucleic acid obtained from a biological sample, and, optionally, at least one primer suitable to enable sequencing of the amplified nucleic acid and determination of the presence of the mutation. The kit can further include at least one oligonucleotide primer specific for the p.Y329S mutation in the GBEl gene to amplify nucleic acid obtained from a biological sample, and, optionally, at least one primer suitable to enable sequencing of the amplified nucleic acid and determination of the presence of the mutation.

Specific reagents for a kit for the detection of the GBEl -deep intronic mutation are pairs of oligonucleotide primers set forth herein, and include:

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Exl6R (SEQ ID NO: 19);

GBEl -Ex 6F (SEQ ID NO: 11) and NEW3'UTR-R (SEQ ID NO: 25);

GBEl-Exl3F (SEQ ID NO: 20) and oligo dT primer;

GBEl-Exl4F (SEQ ID NO: 21) and oligo dT primer, optionally sequenced with a third primer, GBEl-Exl5F (SEQ ID NO: 22);

hGBEl-Ex7F (SEQ ID NO: 6) and hGBEl-Ex7R (SEQ ID NO: 7);

hGBEl-Ex7F (SEQ ID NO: 6) and NEW3'UTR-R (SEQ ID NO: 25); and

GBEl-Intl5F (SEQ ID NO: 9) and GBEl-Intl5R7 (SEQ ID NO: 10).

Specific optional reagents for a kit include pairs of oligonucleotide primers for detection of the p.Y329S mutation including:

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Ex8R (SEQ ID NO: 12);

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-ExlOR (SEQ ID NO: 13)

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Exl lR (SEQ ID NO: 14)

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Exl2R (SEQ ID NO: 15)

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Exl3R (SEQ ID NO: 16)

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Exl4R (SEQ ID NO: 17); and

GBEl -Ex 6F (SEQ ID NO: 11) and GBEl-Exl5R (SEQ ID NO: 18).

A further type of reagent is an array of nucleic acid probes complementary to GBEl -deep intronic mutation (SEQ ID NO: 1) and/or the surrounding/ flanking sequences of the GBEl gene. A variety of different array formats are known in the art with a wide variety of different probe structures, substrate compositions, and attachment technologies.

In some embodiments, the arrays include at least 2 nucleic acid probes, in a more preferred embodiment, at least 5 nucleic acid probes, in a more preferred embodiment, at least 10 nucleic acid probes, in a more preferred embodiment, at least 15 nucleic acid probes, in a more preferred embodiment, at least 25 nucleic acid probes, and in a most preferred embodiment, at least 50 nucleic acid probes, said nucleic acid probes comprising a nucleic acid that is complementary to GBEl-de&p intronic mutation (SEQ ID NO: 1) and/or the surrounding/ flanking sequences of the GBE1 -deep intronic mutation (SEQ ID NO: 1) in the GBE1 gene.

The arrays can further include nucleic acid probes comprising nucleic acids complementary to the nucleic acid comprising Y.329S mutation. In some embodiments, the arrays included at least 2 nucleic acid probes, in a more preferred embodiment, at least 5 nucleic acid probes, in a more preferred embodiment, at least 10 nucleic acid probes, in a more preferred embodiment, at least 15 nucleic acid probes, in a more preferred embodiment, at least 25 nucleic acid probes, and in a most preferred embodiment, at least 50 nucleic acid probes, said nucleic acid probes comprising a nucleic acid that is complementary to the nucleic acid comprising the p.Y329S mutation and/or the surrounding/ flanking sequences of the p.Y329S mutation in the GBE1 gene.. In another embodiment, these nucleic acid probes can be on a separate array found within the kit.

The kit of the invention may include the above-described primers, probes, and arrays as well as additional reagents employed in the various methods, such as: labeling reagents; enzymes such as reverse transcriptase, DNA and RNA polymerases, and the like; various buffers, such as hybridization and washing buffers; signal generation and detection reagents; and reagents for isolation of nucleic acid from a sample.

In addition, the kit may include instructions for practicing the methods of the present invention.

The invention also covers systems for practicing one or more of the above-described methods. The subject systems may vary greatly but typically include at least one element to detect the GBE1 -deep intronic mutation, i.e., one or more reagents described above for detection of the GBE1 -deep intronic mutation, as well as one or more reagents described above for the detection of the p.Y329S mutation, including primers, probes, arrays, and additional reagents for practicing the methods of the invention.

Compositions for Basic Research and Testing of Therapeutic and Preventative Agents

The GBE1 -deep intronic mutations can be used as the basis for screening for agents for prevention and treatment of ABPD as well as for basic research into APBD and other GBE1 related diseases.

In one embodiment, the nucleic acid comprising SEQ ID NO: 1 is contacted with an agent, and a complex between the DNA or RNA and the agent is detected by methods known in the art. One such method is labeling the DNA or RNA and then separating the free DNA or RNA from that bound to the agent. If the agent binds to the DNA or RNA, the agent would be considered a potential therapeutic or preventative for APBD.

A further embodiment of the present invention is a gene construct comprising nucleic acid comprising SEQ ID NO: 1, and a vector. Sequences can be amplified prior to cloning. These gene constructs can be used for testing of therapeutic agents as well as basic research regarding APBD. These gene constructs can also be used to transform host cells can be transformed by methods known in the art.

An exogenous nucleic acid (for example SEQ ID NO: 1 or a nucleic acid complementary to SEQ ID NO: 1, fragments, or variants thereof) can be introduced into a cell via a variety of techniques known in the art.

A eukaryotic expression vector can be used to transfect cells in order to produce proteins encoded by nucleotide sequences. Mammalian cells can harbor an expression vector via introducing the expression vector into an appropriate host cell via methods known in the art.

An exogenous nucleic acid can be introduced into a cell via a variety of techniques known in the art, such as Hpofection, microinjection, calcium phosphate or calcium chloride precipitation, DEAE-dextrin-mediated transfection, or electroporation. Other methods used to transfect cells can also include calcium phosphate precipitation, modified calcium phosphate precipitation, polybrene precipitation, microinjection liposome fusion, and receptor-mediated gene delivery.

Cells to be infected with nucleic acids thereof (for example SEQ ID NO: 1 or a nucleic acid complementary to SEQ ID NO: 1, fragments, or variants thereof) can be primary and secondary cells, which can be obtained from various tissues and include cell types which can be maintained and propagated in culture.

The cells suitable for culturing according to the methods of the present invention can harbor introduced expression vectors (constructs), such as plasmids and the like. The expression vector constructs can be introduced via transformation, microinjection, transfection, lipofection, electroporation, or infection. The expression vectors can contain coding sequences, or portions thereof, encoding the proteins for expression and production.

Expression vectors containing sequences encoding the produced proteins and polypeptides, as well as the appropriate transcriptional and translational control elements, can be generated using methods well known to and practiced by those skilled in the art. These methods include synthetic techniques, in vitro recombinant DNA techniques, and in vivo genetic recombination which are described in Sambrook and Ausubel.

In one embodiment, cells that contain nucleic acids thereof (SEQ ID NO: 1 or a nucleic acid complementary to SEQ ID NO: 1, fragments, or variants thereof) can express a variety of markers that distinguish them from uninfected cells. Expression of markers can be evaluated by a variety of methods known in the art. The presence of markers can be determined at the DNA, RNA or polypeptide level. One such method is the use of an antibody to GBE protein. Other methods include detection of the presence of an RNA sequence, the presence of an RNA splicing or processing, or the presence of a quantity of RNA. These can be detected by various techniques known in the art, including by sequencing all or part of the marker gene RNA, or by selective hybridization or selective amplification of all or part of the RNA.

The resulting transformed cells can be used for basic research as well as testing for therapeutic and prophylactic agents. Specifically, for the latter, the host cells can be incubated and/or contacted with a potential therapeutic or prophylactic agent. The resulting expression of the gene construct can be detected and compared to the expression of the gene construct in the cell before contact with the agent.

These gene constructs as well as the host cells transformed with these gene constructs can also be the basis for transgenic animals for testing both as research tools and for therapeutic and prophylactic agents. Such animals would include but are not limited to, nude mice. Phenotypes can be correlated to the genes and looked at in order to determine the genes effect on the animals as well as the change in phenotype after administration or contact with a potential therapeutic agent.

In particular, a transgenic mouse model can be produced using the GBE-1 -deep intronic mutation and inserting SEQ ID NO: 1 into the mouse. Murine GBE is almost identical to human GBE with a 91% identical mRNA sequence. However, intronic sequences between mice and humans are very different. Thus, the mutation can be "knocked in" the mouse at the same distance as ex on 15 with a 200 base pair flanking sequences (419 base pair full length) to preserve the characteristics of human DNA. Mice naturally harboring the Y.329S homozygous mutation have a 10 to 15% residual GBE activity, whereas heterozygous mice have approximately 60% GBE activity.

These resulting transgenic mice can be examined histologically for the formation and accumulation of PG bodies as well as GBE enzyme activity. Clinical examination of these mice can yield information regarding the effect of PG accumulation in the tissues, especially the nervous system, muscle and liver. Additionally, the onset of symptoms in the mice with the mutations can be established. Thus, these transgenic mice can provide important information regarding APBD symptoms and manifestation. These mice can also be used to test various prophylactic and therapeutic agents, including but not limited to small molecules and anti-sense oligognucleotides.

EXAMPLES

The present invention may be better understood by reference to the following non- limiting examples, which are presented in order to more fully illustrate the preferred embodiments of the invention. They should in no way be construed to limit the broad scope of the invention.

Example 1 - Nucleic Acid Sequences and Primers

The following nucleic acid sequences and primers were used in the examples set forth below.

The sequences of the human 1,4-alpha-glucan branching enzyme (GBE1), and cDNA (mRNA) can be found in the National Center for Biotechnology Information database using the following accession numbers:

GBE1 protein Accession number is NP_000149 GBE1 cDNA (mRNA) accession number is NM_000158.3

Homo sapiens chromosome 3 accession number is NT_022459.

The following primers were used for the experiments described herein:

Primer Pairs for Linkage analysis:

Fl GTGATGCTCTGGTGCACAT (SEQ ID NO: 2)

R.1 TACCCCCTGATAACCATCCT (SEQ ID NO: 3)

F2 CTCAGGTCAGTAGGCACAAAA (SEQ ID NO: 4)

R2 GTGATGACAACCTACGTGAAAA (SEQ ID NO: 5)

Genomic DNA Primers

hGBEl-Ex7F TGTCACATGCTGTTTGGATAT (SEQ ID NO: 6) hGBEl-Ex7R GGTAAAATCCCCTGTACAACA (SEQ ID NO: V) hGBEl-Ex7s CACAATCGGCTGTTTCCTCT (SEQ ID NO: 8)

GBEl-Intl5F TGAGTGTTCTTGGAGCATTTTT (SEQ ID NO: 9)

GBEl-Intl5R7 CCTCCTGAGTAGCTGGGATT (SEQ ID NO: 10) cDNA Primers

GBEl-Ex6F ACTTCCATCCAAGCAAGAGC (SEQ ID NO: 11)

GBEl-Ex8R CGATATTCTTCCAACCACCA (SEQ ID NO: 12)

GBEl-ExlOR ACAGAGCTGGCATTCCTGAT (SEQ ID NO: 13)

GBEl-Exl lR GCCCATGTTCCAGTCTTCAT (SEQ ID NO: 14)

GBEl-Exl2R CCAAAATGCCAGCGACTTA (SEQ ID NO: 15)

GBEl-Exl3R GAGCTGCAAGCCAACCATAT (SEQ ID NO: 16)

GBEl-Exl4R GCTCTTGCTTGGATGGAAGT (SEQ ID NO: 17)

GBEl-Exl5R TCTGATGCCCTCCATATTCC (SEQ ID NO: 18)

GBEl-Exl6R AATTCGGCAGATCCACATTC (SEQ ID NO: 19)

GBEl-Exl3F ATATGGTTGGCTTGCAGCTC (SEQ ID NO: 20)

GBEl-Exl4F ACTTCCATCCAAGCAAGAGC (SEQ ID NO: 21)

GBEl-Exl5F GGAATATGGAGGGCATCAGA (SEQ ID NO: 22)

HGBElcDNA5F GTGAGTGGGCGGAGAGGCCTCGGT (SEQ ID NO: 23)

HGBElcDNA3R ATTGATTGAAATGAAAGACATTTTCT (SEQ ID NO: 24)

NEW3'UTR-R TCAGCTGTTCTGCCTGCCTCG (SEQ ID NO: 25) Example 2- Additional Materials and Methods

Design Setting and Participants: 35 typical APBD patients were studied of whom 16 were homozygous for the NM_000158:c.986A>C (p.Y329S) mutation and 19 were manifesting heterozygotes.

Biochemistry: GBE enzyme activity was measured in leukocytes as described Paradas et al. (2014) and Lossos et al. (1991).

Haplotype analysis: Two microsatellite markers flanking GBE1 were genotyped, (1) at chr3:81312404-81312683 with primer sequences Fl (SEQ ID NO: 2) and Rl (SEQ ID NO: 3) and product sizes in patients of 270, 278, 280 and 282 bp, and (2) at chr3:81751119-81751368, with primer sequences F2 (SEQ ID NO: 4) and R2 (SEQ ID NO: 5), sizes 242, 246, 250 base pairs. Mutation identification: mRNA interruption was determined by nested PCR amplifying cDNA in two rounds, first with GBE1 -Exl3F primer (SEQ ID NO: 20) and oligo dT(T)₁₈, second: the first product was amplified with GBE1 -Exl4 primer (SEQ ID NO: 21) and oligo dT(T)_18. Because of non-specificity of oligo-dT(T)i₈, the resulting product was sequenced with a third primer, GBE1- Exl5F (SEQ ID NO: 22) .

Mutation screening: (IVS15+5289_5297 delGTGTGGTGG ins TGTTTTTTACATGACAGGT) (SEQ ID NO: 1) mutation was screened on genomic DNA (gDNA) by PCR performed with primers G5Ei-Intl5F (SEQ ID NO: 9) and G5£7-Intl5R7 (SEQ ID NO: 10), which generate 290 and 300 bp normal and mutant allele products respectively, sequence was confirmed by Sanger sequencing.

Example 3- Identification and Characterization of the Missing Mutation

in the "Manifesting Heterozygote" Patients

By definition, all manifesting heterozygote patients were heterozygous for the exon 7 c.986A>C mutation in gDNA (Figure 1A). cDNA from leukocyte mRNA was synthesized from these patients using oligo-dT priming (oligo-dT is complementary to the poly-A tail at ends of mRNA). The cDNA was PCR amplified using various primer pairs flanking GBE1 exon 7 (SEQ ID NO: 11 paired with reverse primers SEQ ID NOs: 12-18), and with most pairs obtained the heterozygous c.986A>C sequence as in gDNA. However, when the reverse primer (SEQ ID NO: 19) was placed in exon 16, the PCR product was no longer heterozygous but homozygous for c.986A>C (Figure IB). This suggested that the manifesting heterozygotes generate one transcript containing the exon 7 c.986A>C mutation, and another transcript that lacks exon 16 or part thereof. Clearly, this putative abnormal transcript had a poly-A tail, since the starting cDNA was generated with an oligo-dT primer. PCR-amplification with forward primer was performed in exon 13 (SEQ ID NO: 20) and oligo-dT as reverse primer. The products were a mix with non- GBE1 sequences, unsurprising given the nonspecific nature of oligo-dT priming. To enrich for GBEl, nested PCR was performed amplifying the exon 13-oligo-dT products with forward primer in exon 14 (SEQ ID NO: 21) and oligo-dT reverse, and then sequencing the PCR products with an exon 15 forward primer (SEQ ID NO: 22).

The sequence obtained was the normal GBEl coding sequence until the point where exon 16 should have started. At that point, the sequence became double: the normal exon 16 sequence, and a second, abnormal, non-ex on 16 sequence. This unknown abnormal sequence was blasted against the human genome and found that it is, in part, from GBEl intron 15. This intron 15 region was PCR-amplified in gDNA from manifesting heterozygotes and it was found that a 9 bp 5'-GTGTGGTGG sequence from normal intron 15 was replaced by a 19 bp 5'- TGTTTTTTTACATTACAGGT (SEQ ID NO: 1) new sequence (Figure 2A). This abnormal sequence contains a highly potent mRNA splice acceptor site (Reese et al. (1997)). It appeared exon 15 was splicing into this ectopic splice site, rather than into exon 16.

RT-PCR using forward primer from exon 7 (HGBEl-Ex7F-SEQ ID NO: 6) and reverse from the new abnormal putative exon (NEW3'UTR-R- SEQ ID NO: 25) generated precisely this product, i.e. exon 15 spliced into the ectopic splice acceptor, creating a new, abnormal, exon 16 with a new stop codon (Figure 2B).

Thus it was discovered that the missing mutation in the manifesting heterozygotes is the following designated GBEl -deep-intronic mutation: IVS15+5289_5297delGTGTGGTGG ins TGTTTTTTACATGACAGGT (SEQ ID NO. 1). This mutation generates mRNA encoding a truncated, unstable protein that is degraded. When a forward primer was placed in exon 6 (GBEl-Ex6F- SEQ ID NO: 11) and a reverse primer in the normal 3'UTR (HGBElcDNA3R- SEQ ID NO: 24), the NM_000158:c.986A>C mutation in exon 7 and the normal exon 16 were seen (Figure 2B, top panel). When the reverse primer was in the new abnormal 3'UTR (NEW3'UTR-R- SEQ ID NO: 25), the c.986A>C mutation and the abnormal 'pseudo' exon 16 is seen (Figure 2B, lower panel). Western blotting of leukocyte extracts from the "manifesting heterozygote" patients using an antibody against the middle, unaffected, portion of the GBE protein revealed much reduced total protein compared to p.Y329S homozygote patients (Figure 2C). The GBE activity in the "manifesting heterozygote" patients was 8% of normal (n=3; sd +6), compared to 18% (n=6; sd +4) in simultaneously measured p.Y329S homozygotes. The new mutation was present in all manifesting heterozygotes and was not found in 120 anonymous Ashkenazi individuals.

In light of having identified the second missing GBE1 -deep intronic mutation, whole- genome sequence data were re-analyzed. It was discovered that the mutation was in a region of repetitive sequences that the computerized genome re-assembly had failed to resolve thereby failing to detect the mutation.

The genotype of "manifesting heterozygous" Ashkenazi APBD was found to be that of a compound heterozygote for two mutations: the well-known NM_000158:.986A>C (p.Y329S) and GBE1 -deep intronic mutation, comprising the insertion of SEQ ID NO: 1. Both are founder mutations. No patient was seen that was homozygous for the new mutation. This fact, combined with the greater severity of the new mutation (as determined by reduced enzyme activity using Western blot analysis) and with the absence of any classical GSD-IV patients within our APBD families, indicates that homozygosity for the new mutation is likely prenatal-lethal. On the other hand, compound heterozygosity for the two mutations does not appear to be more severe in the presentation of the disease than homozgosity for p.Y329S, suggesting that 8% residual GBE activity (seen in subjects having the double mutations) is not significantly worse than 18% (seen in homozygous subjects).

One patient with APBD has been identified who has no p.Y329S mutation and is heterozygous for the GBE1 -deep intronic mutation. Although one expects this subject to present with normal activity, the patient has muscle but not neurologic involvement. This suggests that the second mutation by itself in a heterozygote may have adverse effects.

Example 4- Construction of the Targeting Vector for the Knock-In Mouse

A targeting vector will be designed to introduce the human DNA fragment of the GBE1- deep intronic mutation comprising SEQ ID NO: 1 with a 400 bp flanking region, which contains the 3'UTR after stop codon and polyA signal. No mouse sequence will be deleted as the mouse intron 15 is already 800 base pairs shorter than human intron 15. As shown in Figure 4, a 1.1 kb 5' and 6 kb 3' arm and a 0.4 kb modified human intron 15 fragment will be digested with restriction enzymes and fragments will be cleaned and sequentially ligated. A 6.5kb ligated fragment will be cloned into the EcoRI site of a pUC-18 vector. Neomycin and diphtheria toxin alpha chain expression cassettes will also be introduced sequentially as shown.

Example 5- Production of a GBE Knock- In Mouse

The targeting vector from Example 4 will be linearized and transfected in to B6 embryonic stem cells by electroporation in the Transgenic Mouse Facility at Columbia University (New York NY). Briefly, individual transformed colonies will be grown in a 96-well plate. DNA will be isolated from the duplicate of the clones to test the proper recombination by Southern blotting (Figure 5).

Recombinant heterozygous clones without random insertions will be given to the transgenic facility for injection into C57 Black 6J mouse blastocyst. Injection of the blastocyst with embryonic stem cells will produce a chimeric embryo that is composed of both wild type and mutated cells. Chimeric pups will be mated to wild type C57 Black 6J mice in order to transfer the knock-in gene to offspring. This germ line transmission is the milestone for producing the knock-in mouse. After germ line transmission, in order to eliminate the adverse effects of Neomycin cassette, knock-in mice will mate with the mouse strain carrying the Cyclization Recombination gene (Cre) which will cyclize and excise the neomycin cassette via flanking lox-P sites, leaving behind only 34 bp single lox-P sequence.

Example 6- Characterization of the heterozygous and homozygous mouse

for the GBE 1 -deep intronic mutation

According to the genotypes, mice will be divided into three groups: wild-type; heterozygous; and homozygous. 5 male and 5 female mice from each group will be examined at ages 8 weeks and at 6, 12, 18 and 24 months. The following experiments will be done to test the effects of the mutation.

Clinical evaluation: On a daily basis, the mice will be observed for abnormal spontaneous behavior such as immobility, excessive running, stereotyped movements, and abnormal posture, as well as the status of the animals' coat and the grooming. Every other week, more formal clinical evaluations will be performed including weighing the animals and performing neurological examinations. For the neurological evaluation, righting reflex, corneal reflex, salivation, and grip strength will be assessed (Royle et al. (1999)).

On a monthly basis, RotaRod evaluations, open-field testing, and gait analyses will be performed. Motor functions are tested using an accelerating RotaRod (UGO Basile 7650, Comerio, Italy).

There are three potential outcomes of the primary analyses of GBE knock-in mouse: 1) a clear phenotype in the mutant animal: pups will be born and grow to adulthood without any problem, while they are accumulating PG in the tissue. In late adulthood, they develop neuromuscular problems, such as neuropathy and myopathy; 2) a trend towards a difference between GBE knock-in and wild type littermates, which may have PG but may remain unaffected; and 3) No phenotype in mutants. If homozygous or heterozygous G5E-knock in mice demonstrate a debilitated phenotype, they will be sacrificed and the histological and biochemical studies described below will be performed. If mutated animals do not reveal a clinical phenotype, the diet of the homozygous animals will be changed to high carbohydrate and lipid western diet TD 88137 (Harlan Madison, WI) in order to increase glucose intake and glycogen synthesis. Increase in the anabolic state that is not matched with sufficient GBE activity may result in PG accumulation and subsequent neuromuscular defects.

Glycogen histochemistry: Mice will be anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and either killed by intracardiac perfusion of PBS containing 4% paraformaldehyde, or by cervical dislocation. Mouse tissues will be removed carefully and post-fixed overnight in PBS containing 4% paraformaldehyde. Fixed tissue will be further processed for frozen sectioning, by placing them in PBS containing 0.5 M sucrose, pH 7.3, at 4°C until buoyancy is lost. Eight micrometers sections will be cut on a cryostat (Shandon-Lipshaw, Pittsburgh, PA) and mounted on silane-treated slides. For paraffin sections, brain samples will be dehydrated through graded alcohol and embedded in paraffin (PolyFin; Triangle Biomedical Sciences, Durham, NC); sections will be cut to a thickness of 8 um, mounted onto silane-treated slides, dewaxed in xylene, and rehydrated. Glycogen will be determined histochemically in all tissue sections using a periodic acid-Schiff (PAS) kit (Sigma St Louis, MO).

Determination of the steady state RNA levels of GBE1 by real-time PCR: RNA will be isolated from the tissues of wild type, heterozygous, and homozygous animals with Trizol (Invitrogen) as described in the vendor's protocol and quantified. Aliquots of 2 μg RNA will be reverse transcribed by oligo dT priming and real-time PCR performed with primers amplifying 130 bp fragment spanning exon 5 and 6 boundary. The amount of cDNA will be determined by following the increase in fluorescence emitted by cyber green after each thermal cycle. Similarly, beta actin cDNA will be used as a loading control for final determination of relative mRNA transcript.

Western Blot Analysis to determine the relative GBE protein amount: Using an anti-GBE antibody obtained from Origene (Littleton, CO) and standard protocols for Western blotting, the relative amount of human branching enzyme detection will be determined

Branching Enzyme Activity: Frozen tissue samples will be homogenized in all-glass homogenizers in nine volumes of 5 mmol/1 Tris, 1 mmol/1 EDTA, 5 mmol/1 mercaptoethanol, pH 7.2, and centrifuged at 9,200 g for 10 min. Branching enzyme activity will be measured by an indirect assay based on the stimulation of the incorporation of radioactive glucose- 1 -phosphate into glycogen by phosphorylase a as an auxiliary enzyme (Bruno et al., 1993). Excess radioactive glucose- 1 -phosphate will be removed by Sephadex G50 spun column.

REFERENCES

Alkan et al. (2011) Nature Methods 8(l):61-5

Andersen (1956) Lab. Invest. 5(l):l l-20

Bruno et al. (1993) Annals Neurology 33:88-93

Klein (2009) Adult Polyglucosan Body Disease GeneReviews

Lossos et al. (1991) Annals Neurology 30(5):655-62

Lossos et al. (1998) Annals Neurology 44(6):867-72

Mochel et al. (2012) Annals Neurology 72(3):433-41

Neu-Yilik et al. (2011) RNA 17(5):843-54

Paradas et al. (2014) JAMA Neurology 71(l):41-7

Reese et al. (1997) /. Comput. Biol. 4(3):311-23

Royle et al. (1999) Brain Research 816:337-349

Schroder et al. (1993) Acta Neuropathol 85(4):419-30

Ubogu et al. (2005) Muscle Nerve 32(5):675-81

Claims

1. A method for detecting the presence of the GBE1 -deep intronic mutation specific to adult polyglucosan-body disease in the GBE1 gene in the comprising:

(a) obtaining a biological sample comprising nucleic acid encoding GBE1 from a subject;

(b) isolating nucleic acid from the biological sample;

(c) amplifying the GBE1 -deep intronic mutation in the GBE1 gene present in the nucleic acid using polymerase chain reaction utilizing at least one primer that is specific for the GBE1 -deep intronic mutation or that is capable of amplifying a region that contains the GBE1 -deep intronic mutation; and

(d) determining the presence of GBE1 -deep intronic mutation in the GBE1 gene,

wherein the presence of the GBE1 -deep intronic mutation is an indication that the subject is afflicted with adult polyglucosan-body disease or at risk of developing adult polyglucosan-body disease.

2. The method of claim 1, further comprising:

(e) if the subject has adult polyglucosan-body disease then treating the subject, and if the subject is at risk of developing adult polyglucosan-body disease, then monitoring the subject to facilitate early intervention.

3. The method of claim 1, wherein the biological sample is selected from the group consisting of blood, blood cells, lymph, buccal cells, epithelial cells, fibroblasts, cells present in a tissue obtained by biopsy, hair, nails, sputum, saliva, mucosal scraping, amniotic fluid and tissue biopsy.

4. The method of claim 1, wherein the nucleic acid is chosen from the group consisting of RNA, and DNA.

5. The method of claim 1, the primer is chosen from the group consisting of sequences that comprise SEQ ID NO: 1, and sequences that are complementary to SEQ ID NO: 1

6. The method of claim 1, wherein the primers are chosen from the group consisting of:

SEQ ID NOs: 6, 7, 9, 10, 11, 19-22, and 25.

7. The method of claim 4, wherein the DNA is genomic and the primers are chosen from the group consisting of SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 6 and SEQ ID NO: 25; and SEQ ID NO: 9 and SEQ ID NO: 10.

8. The method of claim 4, wherein the isolated nucleic acid is RNA, further comprising reverse transcription of the RNA to cDNA and the primers are chosen from the group consisting of: SEQ ID NO: 11 and SEQ ID NO: 19; SEQ ID NO: 20 and an oligo dT primer; SEQ ID NO:

21 and an oligo dT primer; and SEQ ID NO: 11 and SEQ ID NO: 25.

9. The method of claim 1, further comprising (e) determining the presence of the p.Y329S mutation specific to adult polyglucosan-body disease in the GBE1 gene by amplifying the nucleic acid using polymerase chain reaction utilizing at least one primer that is specific for the p.Y329S mutation or is capable of amplifying a region containing the mutation.

10. The method of claim 9, wherein the primers are selected from the groups consisting of SEQ ID NOs: 11-18.

11. The method of claim 1, comprising detecting said mutation in situ.

12. The method of claim 1, wherein the subject is human.

13. The method of claim 1, wherein the subject is of Ashkenazi Jewish descent.

14. The method of claim 1, wherein the subject is a non-pregnant adult, a pregnant female adult, a child, a human embryo, a human fetus, or an unborn human child.

15. A method for detecting the presence of the GBE1 -deep intronic mutation specific to adult polyglucosan-body disease in the GBE1 gene in the comprising:

(a) obtaining a biological sample comprising nucleic acid encoding GBE1 from a subject;

(b) isolating nucleic acid from the sample;

(c) contacting the nucleic acid encoding the GBE1 with at least two oligonucleotides complementary to SEQ ID NO: 1 or the sequences flanking or surrounding SEQ ID NO: 1 in the GBE1 gene utilizing a microarray; and

(d) determining the presence of GBE1 -deep intronic mutation in the GBE1 gene,

wherein the presence of the GBE1 -deep intronic mutation is an indication that the subject is afflicted with adult polyglucosan-body disease or at risk of developing adult polyglucosan-body disease.

16. The method of claim 15, further comprising:

(e) if the subject has adult polyglucosan-body disease then treating the subject, and if the subject is at risk of developing adult polyglucosan-body disease, then monitoring the subject to facilitate early intervention.

17. The method of claim 15, wherein the sample is selected from the group consisting of blood, blood cells, lymph, buccal cells, epithelial cells, fibroblasts, cells present in a tissue obtained by biopsy, hair, nails, sputum, saliva, mucosal scraping, amniotic fluid and tissue biopsy.

18. The method of claim 15, wherein the nucleic acid is chosen from the group consisting of RNA, and DNA.

19. The method of claim 15, further comprising (e) determining the presence of the p.Y329S mutation specific to adult polyglucosan-body disease in the GBEl gene by contacting the nucleic acid encoding the GBEl with at least one oligonucleotide probe that is complementary for the p.Y329S mutation or sequences flanking the p.Y329S mutation utilizing microarray.

20. The method of claim 15, comprising detecting said mutation in situ.

21. The method of claim 15, wherein the subject is human.

22. The method of claim 15, wherein the subject is of Ashkenazi Jewish descent.

23. The method of claim 15, wherein the subject is a non-pregnant adult, a pregnant female adult, a child, a human embryo, a human fetus, or an unborn human child.

24. A synthetic nucleotide comprising a sequence consisting of from about 10 to about 19 consecutive nucleotides from a nucleic acid sequence of SEQ ID NO: 1 or complementary to SEQ ID NO: 1.

25. A kit for screening for adult polyglucosan-body disease which comprises (a) at least one primer specific for the GBEl -deep intronic mutation identified by SEQ ID NO: 1 to amplify nucleic acids obtained from a biological sample, and, optionally, (b) primers or adapters suitable to enable sequencing of the amplified nucleic acid and determination of the presence of the GBEl -deep intronic mutation.

26. The kit of claim 25, wherein the primer is chosen from the group consisting of: SEQ ID NOs: 6, 7, 9, 10, 11, 19-22, and 25.

27. The kit of claim 25, comprising more than one primer and wherein the primers are chosen from the group consisting of SEQ ID NO: 6 and SEQ ID NO: 7; SEQ ID NO: 6 and SEQ ID NO:

25; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 11 and SEQ ID NO: 19; SEQ ID NO: 20 and an oligo dT primer; SEQ ID NO: 21 and an oligo dT primer; and SEQ ID NO: 11 and SEQ ID NO: 25

28. The kit of claim 25, further comprising (a) at least one primer specific for the p.Y329S mutation to amplify nucleic acid obtained from a biological sample, and, optionally, (b) primers or adapters suitable to enable sequencing of the amplified nucleic acid and determination of the presence of the p.Y329S mutation.

29. The kit of claim 28, wherein the primer specific for the p.Y329s mutation is chosen from the group consisting of SEQ ID NOs: 11-18.

30. A kit for screening for adult polyglucosan-body disease which comprises at least two oligonucleotides complementary to SEQ ID NO: 1 and/or the sequences flanking or surrounding SEQ ID NO: 1 in the GBE1 gene, in a microarray format for identifying GBE1 -deep intronic mutation.

31. The kit of claim 30, further comprising at least two oligonucleotides specific for the p.Y329S mutation in a microarray form for identifying p.Y329S mutation.

32. A method of generating a transgenic mouse comprising integrating into the GBE gene of the mouse genome a nucleotide comprising the sequence of SEQ ID NO: 1.