WO2000029615A2 - A whole-genome radiation hybrid map of the dog genome and use thereof for identifying genes of interest - Google Patents

Abstract

The present invention concerns a map of the dog genome comprising the chromosome location of purified or isolated gene markers, TOASTs, and polymorphic microsatellite markers of said genome. Another aspect is the use of said map for identifying genes responsible for a phenotypic and behavioral trait of interest, for the identification of morbid genes, for analyzing diseases, for identifying the implicated genes of said diseases and their alleles, and for studying dog pedigrees.

Description

A WHOLE-GENOME RADIATION HYBRID MAP OF THE DOG GENOME AND USE THEREOF FOR IDENTIFYING GENES OF INTEREST.

INTRODUCTION

The present invention concerns a map of the dog genome comprising the chromosome location of purified or isolated gene markers, TOASTs, and polymorphic microsatellite markers of said genome. Another aspect is the use of said map for identifying genes responsible for a phenotypic and behavioral trait of interest, for the identification of morbid genes, for analyzing diseases, for identifying the implicated genes of said diseases and their alleles, and for studying dog pedigrees.

BACKGROUND OF THE INVENTION Canis familiaris, the only domesticated species of the Canidae family, is composed of more than 350 breeds offering a very large spectrum of polymorphic traits, behaviours and capabilities. Unfortunately, various breeds are plagued by numerous genetic disorders, many being similar to human diseases (Ettinger and Feldman, 1995). Most breeds have been generated over the past 250 years, a rather short period of time. This suggests that only a small number of key loci are likely to be responsible for the peculiar traits that define a breed (Serpell, 1995; Denis, 1997). It can be postulated that intrabreed uniformity is due to the high degree of genetic homogeneity, at least in the region of the genome submitted to selective pressure.

In this view, dog appears as a particularly attractive and powerful model to study the nature and involvement of the genes responsible for such phenotypic and behavioural diversity (Ostrander and Giniger, 1997). The canine model should also prove very useful in human genetics when the identification of a morbid gene faces two major problems. The first problem is the difficulty to diagnose, down to the molecular level two diseases caused by two different mutated genes while displaying a unique symptomatology. The second comes from the scarcity of large and informative pedigrees. Whenever possible, these two problems are overcome by studying pedigrees from isolated populations in which a single founder effect can be postulated. Resorting to dog should be a promising alternative strategy (Galibert et al, 1998). Indeed, large and fully informative dog pedigrees can be secured rather easily while the unique combination of interbreed diversity with intrabreed uniformity makes dog a model of choice to analyse diseases or other complex mammalian traits and to identify the implicated genes and their alleles.

The key resource for tracking down genes responsible for various polymorphic traits or genetic diseases, is a genome map including polymorphic icrosatellites (Type II markers) and functional genes (Type I markers) regularly spaced along the genome. First, such an integrated map will allow mapping loci through positional cloning. Second, detecting regions where synteny is conserved between different species will favor the identification of many more genes, which in turn will enrich the dog map and facilitate the identification of responsible genes through the candidate gene approach. Integrated maps, comprising Type I and Type II markers, have been proven feasible through the use of Radiation Hybrid panels (Cox et al, 1990; Raeymaekers et al.,1995; McPherson et al., 1997). More recently, integrated whole genome maps have been reported (Hudson et al., 1995; Gyapay et al., 1996; Schuler et al., 1996; ; Stewart et al, 1997) by using the Whole-Genome Radiation Hybrid (WGRH) strategy (Walter et al., 1994). In other mammalian species, the development of the WGRH strategy is in its infancy. Radiation Hybrid (RH) panels have been described for the murine (Schmitt et al, 1996) and the bovine (Womack et al., 1997) species. A whole-genome map of the mouse genome (McCarthy et al., 1997) and chromosome specific maps of the murine (Schmitt et al., 1996) and bovine (Schlapfer et al, 1997; Yang et al., 1998) genomes have recently been published. In dog the meiotic linkage maps, initially reported, only included polymorphic di- and tetranucleotide microsatellite markers (Lingaas et al., 1997; Mellersh et al., 1997).

The present invention concerns an integrated RH map of the canine genome where 400 markers, consisting of gene markers, TOATS and microsatellites -some of which already integrated in meiotic maps-, have been mapped through the WGRH strategy, on a dog/hamster RH5₀₀₀ panel. Positioning these Type I and Type II markers led to a RH map covering approximately 80% of the dog genome. Moreover, gene order comparison in this RH map with that in human, mouse and pig maps allowed to characterize chromosomal segments where synteny has been conserved or, conversely, disrupted.

Therefore, none of the above prior art documents discloses or even suggests the present invention as defined here-below.

DESCRIPTION

The present invention is aimed at a map of the dog genome comprising the genome location of a marker selected from the group consisting of the markers of sequence SEQ ID N° 1-804, as depicted in table 2 below.

The map can comprises the genome location of at least 50, 100, 200, 300 or preferably 400 markers selected from the group consisting of the markers of sequence SEQ ID N° 1-804, as depicted in table 2. This map can have any combination of markers depicted in table 2.

The expression "location" means any relative or absolute measure between two or more markers, any data showing that a given marker is unlinked to another marker, any positioning by membership to a given radiation group or any data showing that a given marker belongs to a radiation group that comprises no other markers.

Another aspect of the invention relates to the use of a map as described above for identifying genes responsible for a phenotypic and behavioral trait of interest, for the identification of morbid genes, for analyzing diseases and for identifying the implicated genes of said diseases and their alleles, or for studying dog pedigrees.

A third aspect concerns the use of a dog genome marker selected from the group consisting of the markers as depicted in table 2 of sequence SEQ ID N° 1-804, or sequence complementary thereto, for identifying genes responsible for a phenotypic and behavioral trait of interest, for the identification of morbid genes, for analyzing diseases and for identifying the implicated genes of said diseases and their alleles, or for studying dog pedigrees. Another object of the invention is a sequence selected from the group of sequences SEQ ID N° 1-804, which can be used for example as a primer for isolating corresponding human gene sequence, especially gene involved in genetic diseases. Preferably, these sequences are the sequences in bold in table 2 below.

DETAILED DESCRIPTION

RH mapping is a powerful method in view of its potential for integrating genetic and physical maps (Hudson et al., 1995; Gyapay et al., 1996; Schuler et al, 1996; McCarthy et al, 1996; Schlapfer et al, 1997; Yang et al, 1998). The major advantages of this strategy include (i) mapping polymorphic and non-polymorphic markers, (ii) unlimited DNA supply and (iii) higher resolution level of a panel of 100 to 200 hybrids compared to an equivalent number of meiosis in genetic linkage mapping. For example, from theoretical considerations (Stewart et al, 1997) the upper resolution limit expected from the RH panel used in the present invention can be estimated as follows. As 1 cR corresponds to 166 kb (see infra), and following Stewart et al, 1997, one can estimate the average size fragments to 16.6 Mb. Thus, the theoretical limit of mapping resolution with this panel is 16.6 Mb /[126 (cell lines) x 0.21 (average retention frequency)], or 0.6 Mb. In addition, the resolution of radiation hybrid mapping being a function of the size of retained fragments, panels at different levels of resolution can be generated by experimentally manipulating the radiation dose (Cox et al, 1990; Walter et al, 1994; McCarthy et al, 1996).

In the human and in the mouse genome, successive maps were generated. Genetic linkage maps harboring framework microsatellite markers (Dietrich et al, 1994; Dib et al, 1997) were first constructed. Subsequently genes, STS and EST were mapped either using RH panels (Gyapay et al, 1996; Hayes et al, 1996; McCarthy et al, 1997) or YAC or BAC libraries (Hudson et al, 1995; Kim et al, 1996). Finally, these markers have been remapped relative to a framework map containing polymorphic genetic markers (Hudson et al, 1995; McCarthy et al, 1997). In an effort to construct a map of the dog genome with a view to tracking down genes of interest, and to bypass the successive steps followed in the construction of the human or mouse genome maps, we chose to produce an RH map including Type I and Type II markers in one step. With this end in view, we mapped 400 markers (218 genes and 182 microsatellites), 121 of which had been analyzed previously by Lingaas et al, 1997; Mellersh et al, 1997; or Werner et al, 1997. Mapping on the RH panel markers already mapped by others ensured a higher confidence in the mapping results and allowed to merge meiotic and RH groups into an expanded integrated map.

The coverage of the map has been estimated from the chances that any new marker will integrate into one of the linkage group. From the 180 marker on, we observe that any new marker had a 80% chance to be linked to another marker with a lod score 6 or greater. Assuming those markers are most probably randomly distributed within the genome, coverage can be estimated to ~ 80%.

The total size of all 57 RH groups amounts 7995 cR. The data obtained from the RH2PT analysis computed at lod 6 allow detection of linkage between markers located 50 cR apart. This value can be added to each side of the RH groups, which extends the RH group coverage to 13,695 cR. This may be an overestimate due to the fact that some markers can be located close to telomeres. On the other hand, it does not take into consideration the estimated coverage corresponding to the 53 unlinked markers.

RH mapping has been shown to constitute a particularly powerful tool in comparative gene mapping, since chromosomal order can be established for expressed genes that are usually conserved between species (O'Brien et al, 1993; Johansson et al, 1995; Chowdhary et al, 1996), but often do not led themselves to a genetic linkage mapping approach for lack of readily detectable allelic variation. In such a challenge, it is of paramount importance to anchor a maximum number of common markers, which could be facilitated by the use of reagents such as TOASTs (Jiang et al. , in press), CATS (Comparative Anchor Tagged Sequences, Lyons et al, 1997) or UMPs (Universal Mammalian Primers, Venta et al, 1996). The present RH map, even if additional assigned genes are required, already reveals strongly conserved regions when referred to the human, mouse and pig genomes. These syntenic relationships, essential for understanding evolution, can also be used in a more methodical approach to further upgrade the dog map by mapping homologous genes selected from high density-map species. Usually, the construction of a map consisting of polymorphic markers requires nearly ten times as many markers than needed to get an even distribution (one marker every 5 cM). However, if a set of regularly spaced genes has first been described using synteny relationships, it should be possible from these to select the corresponding BAC recombinant clones and consequently cognate polymorphic microsatellite. A dense map, integrating Type I and Type II markers evenly distributed on the dog genome, is useful for localizing and identifying genes implicated in phenotypical and behavioural traits as well as genetic diseases.

Radiation hybrid mapping A total of 400 markers composed of 218 gene markers and 182 microsatellites (see Table 1 below) were typed on a WGRH panel made of 126 radiation hybrid cell lines. Basing on statistical analysis (RH2PT of RHMAP 3.0 package, Boehnke et al, 1991), 347 markers out of 400 have been assigned to 57 radiation hybrid groups, while 53 markers remained unlinked Table 2 below. RH groups were formed such that any marker in the group had a lod score 6 or greater with at least one other marker. Out of the 57 RH groups, 11 comprise ten or more markers -the largest (RH11) comprising 21 markers-, 17 RH groups include five to nine markers and 13 contain three or four markers. The remaining 16 RH groups have two markers each. All the RH groups containing at least three markers have been ordered and the distances calculated using the RHMAXLIK program of RHMAP 3.0 (Table 2). Distances between markers are expressed in centiRays (cR), 1 cRsooo being defined as 1% frequency of breakage between two markers after exposure to 5000 rads of gamma-rays (Cox et al, 1990). RH groups range in size from 9 cR (RH06 with two markers) to 588 cR (RH14 with 18 markers). The average distance observed between two adjacent markers is 23 cR. Table 1 : Type, number and reference of markers typed on the dog/hamster RH panel

Markers Number of References markers

Type I markers: coding sequences 218 Present

Dog gene markers 169 invention

TOAST : Traced Orthologous Amplified Sequence Tags 25 1

HuEST : Expressed Sequenced Tags 14

Previously published dog gene markers 10 3

Type II markers: repeated sequences 182

Tri- or di-nucleotides selected 35 Present in the lab invention markers selected from dog tetranucleotide repeats 72 4 dinucleotide repeats 49 5 previously published microsatellites 26 6

References correspond to : (1) Jiang et al, 1998, (2) Lachaume et al, 1998; Langston et al, 1997; Werner et al, 1997, (3) Gyapay, Gέnέthon, France, (4) Francisco et al, 1996; Mellersh et al, 1997, (5) Ostrander et al, 1993, 1995; Lingaas et al, 1997, (6) Holmes et al, 1993a, 1993b, 1995; Molyneux et al, 1994; Mariat et al, 1996; Dolf et al, 1997, in press; Thomas et al, 1997; Schelling et al, in press; Switonski et al, in press; Yuzbasiyan-Gurkan (http://www.cvm.msu.edu/text/res/c_lmm.html). > W r

glycerhaldehyde 3 P

A0091 ATTTTTTGATGTACGTTTTGCTACC TAAGTGAGTTTTTAGAGCCCCTAGG 60 129 deshydrogenase thyrotropin receptor A0010 TGATGTTTCATGGGGCAAATTTC GTGAGAAGCTCAATGTTGACCTGGT 60 221 tyrosine amino- BD0381 CCCGGAGTCACACAGGAG GTGCCCCAGCAAATGTATTAAT 55 180 transferase rod photoreceptor phosphodiesterase AD0301 AAGCAGCGGCAAACCAGG CCAGGCCTTCCATTCCAGG 60 379 gamma glycoprotein lb BD0312 AGGCCTTAAGCACCTTTTCTG CTCGTCTTGGTGCATCTCTTC 55 252 preproenkephalin beta A01042 AGGACCCCAAGGAGCAGGTC TCTTCCTGAGACCGAGTAACCACC 60 238 aminolevulinate delta

A0085 GATAAGCAGAGGTCTGGGAAAGGAA CTTACCTGGAGATAATGGGGGGAG 60 139 synthetase 2 Duchenne muscular

A0124 TGGAGCCGAGCACACAGC CCAAGAGTAGAGTTCCTTTGCCACA 60 144 dystrophin Bombesin receptor

L08893 TGCGTAAACCCCTTTGC TACACCCAGTGAACGAGGTC 47 202 subtype 3 interleukin 2 receptor,

A0072R AGTGAATGGCTCTGCCACGTC GTGAGCATTGGACCCAGGTTG 60 224 gamma chain collagen typeIN

A0075R CCCTGGACCAGATGGAATG ACCGTGAGCTCTTTTATTTCCTTGG 60 181 alpha 5 clotting factor IX A0129 ACATCAACTCCTGCGTCTCATCC GCCACCAGTACATCCTTCTCCACT 60 221 hypoxanthine phospho

B0084 TGGAGATGACCTCTCAACTTTAACT TTTTGGATTATACTGCGCGAC 55 115 ribosyl transferase sex determining region A0081 GAACGCATTCTTGGTGTGGTCTC GGCCATTTTTCGGCTTCTGTAAG 60 132 zona pellucida 2

A0122 GACTCAAAAGGGCACAGGGCT AACACCATGGTTCTTTTCTTACGCA 60 128 glycoprotein mucin A0152 TGCTCTCTTCCTTCCCACATCC ACACTGCCGGGAGGAGACAC 60 164 chloride channel B0002 TTTACCTGAACCAGTTCTTTTTTTG GATGCATATAGTGAAAGCAGGAACT 55 201

Tsble 2 legend : Groups of markers are termed sRHa (containing several RHa groups) or RHa (containing one RH group) The suffix a is added to date the RH map When the chromosome assignment is known, it is indicated as CFA (Canis Familiaris) Primer sequences characterized in the laboratory are indicated in bold For PCR conditions "Ta" is the annealing temperature The suffix L indicates an annealing step of 45 sec Sizes of the PCR products are indicated in bp, "int" indicates the presence of intron(s) and subsequently the size of the product is unknown Lod scores and distances values between two markers (locus 1 on the upper line and locus 2 on the lower) are indicated on the lower line Distances are shown in centiRays (cR) ND not determined PCR Programs:

- Prog. 1 to 4 : 95°C for 12 min, 30 cycles of 94°C for 30 sec, 60°C (prog 1), or 55°C (prog 2 and 4), or 50°C (prog 3) for 30 sec, 72°C for 30 sec

Final step of 72°C for 5 min (except prog 4)

- Prog. 5 to 8 : 95°C for 12 min, 21 cycles of 94°C for 30 sec, 69°C (prog 5), 63°C (prog 6), or 59°C (prog 7), or 54°C (prog 8) for 30 sec, then a decrease of 0 5 °C per cycle, 72°C for 30 sec 12 cycles of 94°C for 30 sec, 59°C (prog 5), 53°C (prog 6), or 49°C (prog 7), or 44°C (prog 8) for 30 sec, 72°C for 30 sec

- Prog. 9 : 95°C for 12 min, 8 cycles of 94°C for 30 sec, 62°C for 45 sec, 72°C for 45 sec 25 cycles of 94°C for 30 sec, 65°C for 30 sec, 72°C for 30 sec Final step of 72°C for 5 min

- Prog. 10 to 13 : 95°C for 12 min, 20 cycles of 94°C for 30 sec, 65°C (prog 10), 63°C (prog 11), or 59°C (prog 12), or 61°C (prog 13) for 30 sec, then a decrease of 2 °C per 4 cycles, 72°C for 30 sec 25 cycles of 94°C for 30 sec, 55°C (prog 10), 53°C (prog 11), or 49°C (prog 12), or 55°C (prog 13) for 30 sec, 72°C for 30 sec Final step of 72°C for 2 min

- Prog. 14 to 16 : 95°C for 12 min, 8 cycles of 94°C for 30 sec, 57°C for 45 sec (prog 14), 60°C for 25 sec followed by 58°C for 20 sec (prog 15), or 58°C for 45 sec (prog 16), 72°C for 45 sec. 25 cycles of: 94°C for 30 sec, 60°C (prog 14), 65°C (prog 15), or 61°C (prog 16) for 30 sec, 72°C for 30 sec. Final step of 72°C for 5 min.

Marker retention The average retention frequency of the 400 markers on the RH panel is 21%, with 82% of the markers having a retention frequency between 10% and 40%. Four of the markers displaying extreme retention values were above 80%. This is not surprising for two genes (SRP68 and Galkl) known to be localized on canine chromosome 9 (Werner et al, 1997) in the vicinity of the TK gene used for the selection of the hybrid cell lines. Another marker, also presenting a high retention frequency and corresponding to the huEST L08069, has not yet been linked to any other. It encodes a member of the DNA J family of chaperone proteins and caution will be needed before incorporating this marker into a linkage group. The fourth marker, still unlinked, corresponds to the anonymous microsatellite Ren01E15. It does not match any known dog repeated sequence and we have no explanation for its high retention value. The medium-high (40-80%) retention profile presented by 28 markers might be due to their specific chromosomal location. Indeed, as previously observed in the human genome, there is a general trend towards increased retention for landmarks located on smaller chromosomes (Gyapay et al, 1996). This may be related to the high retention frequencies of markers near the centromere. In the canine genome, this is illustrated by gene SR7, localized on the dog Y chromosome, that has a retention value of 40% on the RH panel. This particularly high value for a gene located on a sex chromosome may be correlated to the fact that the Y chromosome is the smallest. Conversely, eight gene markers (CHM, PGK1, HPRT, IL2RG, AR, DMD, F8C and F9) known to belong to the dog haploid X chromosome exhibit retention frequencies approximately half those of autosomes, a finding in agreement with previous observations in the human genome (Gyapay et al, 1996). Finally, none of the radiation hybrid cell lines has retained the locus corresponding to the P53 tumor gene, located on canine chromosome 5 (Guevara-Fujita et al, 1996), although this marker was detected in the DNA of original dog cells used for the RH panel. The fact that only one marker out of 400 was not retrieved suggests that the RH panel almost covers the entire dog genome. Assignment of linkage groups to canine chromosomes

With the exception of the X chromosome, the 39 pairs of dog chromosomes are all acrocentric and many are too small and too similar to be reproducibly identified by cytogenetic techniques (Langford et al, 1996; Reimann et al, 1996; Switonsky et al, 1996). Recently, FISH analyses on dog chromosomes have been performed resulting in an increased number of mapped markers. In this study, some of the latter were typed on the WGRH panel, which allowed to assign 14 RH groups to 9 canine chromosomes and one RH group to a subset of undistinguishable dog chromosomes (# 29 to 35), as indicated in Table 3 below. Table 3 : Chromosomal assignments of RH-a groups and unlinked markers

Dog Radiation Hybrid Markers previously Ref.

Chromosome group (RH-a) localized by FISH

CFA 3 RHOl-a, RH02-a, RH03-a ZuBeCa 4 1

RH04-a, RH05-a IGHA, IGHE 2

CFA 4 RH06-a, RH07-a GALK1, NFl, RARA, THRAl, 3

CFA 9 BRCA 7,ZuBeCa3

RH27-a 4

CFA 10 RH28-a ZuBeCal 2

CFA 12 RH29-a DLA-88 5

CFA 13 RH30-a CanBern 1 6

CFA 18 RH08-a, RH09-a AHTk32 6

CFA 20 RH31-a AHTk20 6

CFA 29-35 RHlO-a/unlinked markers AHTk336 2, 7

X PGK1, CHM/HPRT L2RG,

Unlinked marker DMD,F8C,F9,AR

Y SRY 8

References of assignments correspond to ( 1 ) Dolf et al. , in press, (2) Dutra et al. , 1996 (3) Werner et al, 1997; Switonski et al, in press, (4) Schelling et al, in press, (5) Dolf et al, 1997, (6) Fischer et al, 1996, (7) Deschέnes et al, 1994, (8) Langston et al, 1997. These assigned RH groups are designated as CFA (Canis familiaris) followed by the chromosome number (CFA # in Table 2). However, most of these chromosomal assignments are based on the cytogenetic location of only one marker per RH group. In view of the rather complicated design of the canine karyotype, other cytogenetic assignments are needed to confirm these correspondences. Concerning dog chromosome 9 (CFA9-RH06 and RH07), detailed physical and genetic maps have been described (Werner et al, 1997) with four of the assigned loci ordered in two RH groups. As a consequence, the assignment of these groups to CFA9 was made with higher confidence. As for the RH04 group, it contains two genes (IGHE, IGHA) of the immunoglobulin family. Previous FISH assignment of the canine immunoglobulin heavy-chain (IGH) locus to CFA4 (Dutra et al, 1996) as well as the clustered organization of this gene family in different mammals (O'Brien et al, 1993) are in favor of an assignment of RH04 group to CFA4. Two of the eight genes known to belong to the dog X chromosome are present in the RH10 group while six were not found to belong to any group. This could be due to the large size (137Mb) of this chromosome (Langford et al, 1996). Finally, the RH31 group contains a microsatellite marker, AHTk336, previously localized to the subset of chromosomes 29 to 35 (Fischer et al, 1996). Further cytogenetic assignments of markers belonging to this subset will help characterise these small chromosomes. Comparison of RH and meiotic maps The power of radiation hybrid strategy, within the frame of the human genome mapping project, has been shown to reside in the capacity to order Type I and Type II markers and to get integrated meiotic and physical maps (Hudson et al, 1995; Gyapay et al, 1996; Schuler et al, 1996). In dog, positioning on the RH map 121 markers already typed on meiotic maps (Lingaas et al, 1997; Mellersh et al, 1997; Werner et al, 1997) enabled to merge RH and/or meiotic linkage groups. Thus, 26 RH groups and 3 unlinked loci could subsequently be merged into 13 larger groups termed syntenic groups and designated as sRHOl to sRH13 in Table 2. As an example, sRHOl could be defined through the linkage of 3 RH groups (RH01, 02 and 03) using 7 markers belonging to a single meiotic group (Ll group described by Mellersh et al, 1997). The largest syntenic group, sRH06, contains 24 markers and reaches 674 cR in size. Alignment of RH and meiotic groups also permitted to join some previously published dog meiotic groups. An example in point is syntenic sRH07 group that bridges the L27 and L15 meiotic groups (Mellersh et al, 1997), as does sRH12 group for L7 and Ll DogMap meiotic groups (Lingaas et al, 1997; Mellersh et al, 1997). Moreover, mapping markers by two independent methods provided higher confidence in their order. Detailed comparisons of the most probable order of the 121 markers common to the RH and meiotic maps demonstrated both approaches to coincide, with only one discrepancy in the sRH06 group. Two microsatellite markers, Cxx246 and Cxx424, have permuted positions in radiation hybrid RH11 and meiotic Ll groups. However, as Cxx246 is a non-framework marker in the RH map, its position will be subjected to local optimization after integrating more markers. Correlation of RH map units with genetic and physical distances

In addition to providing increased mapping informativeness, the comparison between RH and meiotic maps allowed to correlate the CR5000 map units and the genetic distances for the same set of markers in different regions of the dog genome. In this study, the distances both in centiRays and in Kosambi centiMorgans (cM) were scored for 26 pairs of markers, as reported in Table 4 below. As these markers originated from different groups and most likely from different chromosomes, the calculated cR cM ratios, ranging from 1 to 33, may provide a good estimate of the variation prevailing throughout the entire dog genome. Such variations, described in previous human chromosome mapping analyses, reflect the fact that genetic distances are not uniform along the genome. They might also reflect the existence of "hot spots" for breakage during gamma irradiation (Rayemakers et al, 1995). Likewise, variation by a factor of 25 was observed for the RH mapping of human chromosome 18 (Francke et al, 1994). For the purpose of the present map, the values given in Table 4 resulted in the equivalence of 6 CR5000 for cM. Assuming that the recombination rate in the dog and human genome is similar, the correspondence, IcM for 1Mb, commonly accepted for the human genome, would apply to this RH panel, so that one CR₅₀0₀ can be estimated to 166 kb. This estimate is in agreement with other correlations observed for different human chromosomes (Cox et al, 1990; Francke et al, 1994; Gyapay et al, 1996; McPherson et al, 1997), or in the mouse genome (Schmitt et al, 1996; McCarthy et al, 1997) for comparable radiation doses (3000-8000 Rads). Similarly, the Genebridge 4 panel (Gyapay et al, 1996), which served as a reference in the establishment of our dog RH panel (Nignaux et al, in press) also exhibits ratios varying from 110 kb/cR to 305 kb/cR. Table 4 . Comparing distances in centiRays and Kosambi centiMorgans

SRH-a RH-a Marker 1 Marker 2 cR5000 ^a cM ^b cR cM

01 02 FH2107 FH2145 230 30.6 8

01 02 FH2145 FH2320 15 6.2 2

01 02 FH2320 FH2131 139 8.5 16

02 05 FH2144 FH2149 218 24.7 9

03 07 THRAl/RARA NFl 169 31.2 5

03 07 FH2263 FH2186 145 16.1 9

06 11 FH2294 FH2326 86 14.8 6

06 11 FH2326 FH2309 142 15.0 9

06 11 FH2309 Cxx246 199 32.2 6

06 11 Cxx246 Cxx424 68 19.1 4

06 12 FH2313 FH2016 53 19.5 3

07 14 FH2141 FH2318 129 16.9 8

08 17 FH2201 Cxx767 37 17.8 2

09 19 FH2001 Cxx277 62 45.6 1

10 20 FH2177 Cxx002 47 8.0 6

12 23 FH2168 FH2010 125 4.9 25

- 28 FH2152 FH2054 60 13.5 4

- 30 FH2155 Cxxl47 45 22.1 2

- 32 FH2237 Cxx30 124 32.1 4

- 33 FH2171 FH2295 111 10.7 10

- 33 FH2295 FH2360 82 11.2 7

- 34 vWF FH2346 74 11.4 6

- 35 FH2130 Cxx733 22 8.9 2

- 36 CPH10 CPH5 269 19.0 14

- 39 Cxx442 FH2289 80 2.4 33

- 46 FH2161 FH2312 6 7.2 1

Total 26 2737 ^c 449.6 ^a Distances in centiRays (cRsooo) obtained in the RH-a groups reported in this work.

^ Distances in Kosambi centiMorgans (cM) obtained in meiotic groups, previously published by Lingaas et al, 1997; Mellersh et al, 1997; Werner et al, 1997. ^c From these two data series, the correspondence of 6 cR for 1 cM (2737/449.6) is obtained.

Comparative gene mapping

As they are generally not conserved between species, polymorphic microsatellites are useful reagents in linkage studies, but of little value in comparative mapping studies. In contrast, mapping Type I markers allows to exploit data gathered by cytogenetic studies and/or physical mapping in different mammalian species. Out of the 218 gene markers mapped in this study, 174 have been localized on human (HSA), 93 on mouse (MMU) and 23 on pig chromosomes (SSC). Considering only those genes that have been localized in human, 147 are distributed over all RH groups, 27 genes remaining unlinked. And all human chromosomes have a counterpart in at least one dog linkage group, except for HSA18. As for chromosome Y, the smallest dog chromosome, it only harbours one unlinked marker, the SRY gene.

The counterpart in dog of a given human chromosome is most generally split in two to five RH or sRH groups. For example, HSA12 appears in dog RH groups 27, 33, 34, 35 and 39. This is not surprising when the sizes of the HSA and that of the dog RH groups are compared. Nevertheless, the majority of RH groups correspond to two to five different human chromosomal fragments. Furthermore, assignment of several dog RH groups to some canine chromosomes (see Table 3) allowed to point out relationships between CFA and HSA chromosomal fragments. For instance, HSA4 corresponds to CFA3 (sRHOl) and CFA 13 (RH29) and, conversely, CFA3 shares homologies with HSA4p, 5q and 15q (Table 2). Taken all together, these data are in agreement with the extent of chromosomal segment conservation already observed in other map comparisons (O'Brien et al, 1993, 1997α, 1997/3; Johansson et al, 1995; Womack et al, 1997). Synteny has been analyzed whenever comparison between dog RH groups, human, mouse and pig chromosomal locations was feasible. As expected, the dog X chromosome (part of it being represented by the sRH05 group) displayed homology with its human and murine counterparts (O'Brien et al, 1993). Seven of the other RH groups were conserved en bloc between the dog, human and mouse species. The largest block is a part of the sRH03 group (CFA9), homologous to HSA17q and MMUl l, and reaches 300cR (slightly less than 50 Mb). A case of conservation of synteny between the four species is demonstrated in the sRH06 group over a distance of lOOcR (16.6Mb). The RH28 group, corresponding to CFA12, contains 14 markers ordered over 195 cR. Six of these are MHC genes and 2 are genes commonly associated to the MHC locus, namely tumor necrosis factor (TNF) and colipase (CLPS). Such clustering is in agreement with the conservation of the whole MHC organization in human (HSA6pl2-p21), mouse (MMU17), pig (SSC7) and rat (chromosome 20) genomes (O'Brien et al, 1993; Yamada et al, 1994; Archibald et al, 1995), and reinforces the notion of a high conservation during mammalian evolution. However, an unexpected synteny breakage concerns one dog MHC class I gene, DLA-79. While its human counterpart has been localized to 6p21 (Burnett et al, 1995) and three different markers corresponding to this gene have been independently tested (data not shown), this gene has been constantly incoφorated into a different group, RH30. Consequently, this difference in localization may be attributed either to an unexpected translocation carried by the dog DNA used for establishing the RH cell lines, or to a disruption of synteny in this chromosomal region so far observed only in dog.

The majority of the other syntenic disruptions are unique to the dog genome relative to the human and mouse genomes and have been observed in nine RH groups. For instance, group sRH04 shows homology to two human chromosomes, HSA3p and 19p, and to two mouse chromosomes, MMU6 and 9. Moreover, for two dog RH groups for which pig data are available, disruptions observed in the dog-human and dog-mouse comparisons are also noted in dog-pig comparisons (RH36 and RH33 groups). Conversely, cases where synteny is conserved between dog and human, but disrupted between mouse and dog, are less frequently observed and are illustrated by only two RH groups (RH30 and RH38). Gene organization observed in this RH map sheds light on numerous syntenic conservations between dog, human and mouse genomes. The syntenic disruptions observed reflect ancestral rearrangements that occurred between the carnivora and the human and murine species.

EXAMPLE 1 : GENERATION OF RADIATION HYBRID CELL LINES

A panel of radiation hybrid cell lines was constructed as described by Vignaux et al, (in press). Mongrel dog fibroblasts were irradiated by a 5000-rad gamma ray exposure. Cells were then fused with thymidine-kinase deficient hamster cells (HTK3-1) in the presence of polyethylene-glycol according to Benham et al, 1989. Following selection in HAT medium and cell culture in roller bottles, DNA was extracted from individual clones (Hόglund et al, 1995). After verification of the presence of dog DNA and analysis of the retention profiles, a total of 126 radiation hybrid cells were expanded to prepare a minimum of 2.5 mg genomic DNA. This WGRH panel, named RHDF5000, was used to map the canine genome.

EXAMPLE 2: DEVELOPMENT OF MARKERS

Dog genes - Using the PRIMER program (GCG, 94), oligonucleotide primer pairs were designed from dog gene sequences present in the GenBank database (Table 1).

TOAST (Traced Orthologous Amplified Sequence Tags) - Genes whose sequence was determined in two or more mammalian species, including one at least at the genomic level, were selected to develop orthologous gene-specific universal primers. All the fragments amplified by PCR with TOAST primers were sequenced before use to verify by BLAST searches that they did correspond to the orthologous genes (Table 1 ; Jiang et al, in press).

huEST (Expressed Sequenced Tags) - Optimal PCR conditions were determined on dog genomic DNA for some (Table 1) of the numerous EST primers designed for the mapping of the human genome (provided by G. Gyapay, Genethon, France).

Microsatellites - A set of tri- and dinucleotide microsatellites characterized from a small insert canine genomic library as well as additional dog microsatellites from the literature were typed (Table 1). EXAMPLE 3: GENERATION OF A RADIATION HYBRID MAP Screening dog versus hamster specific markers - Each marker was tested on dog, hamster and a mix of dog/hamster (1:2) DNA in order to mimic RH DNA content. PCR were optimized to obtain a dog specific PCR product.

PCR analysis on the radiation hybrid cell lines - PCR was performed on 50 ng RH DNA in a final volume of 10 μl containing 15 ng of each primer, 200 μM dNTPs, 1.5 to 3 mM MgCl₂, 50 mM KC1, 10 mM Tris-HCl and 0.5 U of Taq Gold polymerase (Perkin Elmer). Amplification was carried out with Techne (Techne, Cambridge, MA) or MJ (MJ Research, Cambridge, MA) thermocyclers. PCR products were analyzed by migration in 1.8% agarose gels for 30 min at 120 V in 0.5X TBE buffer (Hybaid electrophoresis system) and were visualized under UN light after ethidium bromide staining. Images of the gels were recorded with a high resolution CCD camera (BioPrint, Nilber Lourmat, Torcy, France). Results were scored as present, absent or ambiguous in a semi-automated fashion on a UNIX workstation using a data acquisition software developed by G. Brenterch and N. Soriano (Nicolas.Soriano@univ-rennesl.fr). PCR analysis of each of the 400 markers was carried out in single assays and scoring of the results was performed with considerable caution. Moreover, 40 markers were tested twice on the panel with identical results. Slight discrepancies regarding the presence or absence of a PCR product were noted in 1 to 4 hybrid cell lines (out of 126) at the most. None of these significantly altered the mapping results.

Statistical analysis of radiation hybrid data - Order and intermarker distances were determined using two-point and multipoint likelihood methods of statistical analysis (Boehnke et al, 1991). This method assumes that gamma-ray breakage along the genome is random and that fragments are independently retained. The statistical package RHMAP 3.0 consists of three programs : RH2PT, RHMINBRK and RHMAXLIK. The two-point analysis program (RH2PT) was used to identify pairs of loci with lod scores greater than 6 and to derive RH groups from these data. RHMINBRK performs multilocus ordering by minimization of obligate breaks required to explain the data. For largest linkage groups, the RHMINBRK order was used as candidate for RHMAXLIK analysis, which performs multilocus ordering by maximization of the likelihood of the hybrid data. Equal retention model was used for all marker analysis. Multipoint analysis was carried out by positioning markers as framework at 1000: 1 and 100: 1. Non- framework markers were then positioned with most favorable order. Stepwise locus ordering was used to reduce computing time. Finally, selected locus model 1, allowing one retention probability for a fragment containing the selectable locus, was used to verify locus order of the linkage group containing the TK locus.

EXAMPLE 4: COMPARATIVE MAPPING

Cytogenetic data for human, mouse and pig genes were extracted from the Genome Databases: http://bisance.citi2.fr/GENATLAS : http://www.ncbi.nlm.nih. gov/Uni Gene/index, html.

We applied the chromosome nomenclature of ISCN (1978): dog chromosomes are denoted CFA (Canis familiaris), human chromosomes, HSA (Homo sapiens), mouse chromosomes, MMU (Mus musculus) and pig chromosomes, SSC (Sus scrofa).

REFERENCES

Archibald, A.L., Haley, C.S., Brown, J.F., Couperwhite, S., McQueen, H.A., Nicholson, D., Coppieters, W., Van de Weghe, A., Stratil, A., Wintero, A.K. et al. (1995). The PiGMaP consortium linkage map of the pig (Sus scrofa). Mamm. Genome 6: 157-175.

Benham, F., Hart, K., Crolla, J., Bobrow, M., Francavilla, M. and Goodfellow, P.N. (1989). A method for generating hybrids containing nonselected fragments of human chromosomes. Genomics 4: 509-517.

Boehnke, M., Lange, K. and Cox, D.R. (1991). Statistical methods for multipoint radiation hybrid mapping. Am.J.Hum.Genet. 49: 1 174-1188.

Burnett, R.C. and Geraghty, D.E. (1995). Structure and expression of a divergent canine class I gene. J. Immunology 155: 4278-4285.

Chowdhary, B.P., Frόnicke, L., Gustavsson, I. and Scherthan, H. (1996). Comparative analysis of the cattle and human genomes : detection of ZOO-FISH and gene mapping- based chromosomal homologies. Mamm. Genome 7: 297-302.

Cox, D.R., Burmeister, M., Price, E.R., Kim, S. and Myers, R.M. (1990). Radiation hybrid mapping: a somatic cell genetic method for constructing high-resolution maps of mammalian chromosomes. Science 250: 245-250.

Denis, B. (1997)."Genetique et selection chez le chien" (PMCAC and SSNOF, Eds.), Pairault SA, France.

Deschenes, S.M., Puck, J.M., Dutra, A.S., Somberg, R.L., Felsburg, P.J. and Henthorn, P.S. (1994). Comparative mapping of canine and human proximal Xq and genetic analysis of canine X-linked severe combined immunodefiency. Genomics 23: 62-68. Dib, C, Faure, S., Fizames, C, Samson, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S., Hazan, J., Seboun, E. et al. (1997). A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380: 152-154.

Dietrich, W.F., Miller, J.C., Steen, R.G., Merchent, M., Damron, D., Nahf, R., Gross, A., Joyce, D C, Wessel, M., Dredge, R.D. et al. (1994). A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nature Genet. 7: 220-225.

Dolf, G., Schlapfer, J., Parfitt, C, Schelling, C, Zajac, M., Switonski, M., and Ladon, D. (1997). Assignment of the canine microsatellite CanBernl to canine chromosome 13q21. Animal Genet. 28: 156-157.

Dolf, G., Schlapfer, J., Switonski, M., Stranzinger, G., Gaillard, C. and Schelling, C. The highly polymorphic canine microsatellite ZuBeCa4 is localized on canine chromosome 3ql5-ql8. _4«/ wα/ Ge?7et. in press.

Dutra, A.S., Mignot, E. and Puck, J.M. (1996). Gene localization and syntenic mapping by FISH in the dog. Cytogenet. Cell Genet. 74: 113-117.

Ettinger, S.J. & Feldman E.C. (1995). "Textbook of veterinary internal medecine", 4th edition, Saunders Company.

Fischer, P.E., Holmes, N.G., Dickens, H.F., Thomas, R., Binns, M.M. and Nacheva, E.P. (1996). The application of FISH techniques for physical mapping in the dog (Canis familiaris). Mamm. Genome 7: 37-41.

Francisco, L.V., Langston, A.A., Mellersh, C.S., Neal, C.L. and Ostrander, E.A. (1996) A class of highly polymorphic tetranucleotide repeats for canine genetic mapping . Mamm. Genome 7: 359-362. Francke, U., Chang, E., Comeau, K., Geigl, E.-M., Giacalone, J., Li, X., Luna, J., Moon, A., Welch, S. and Wilgenbus, P. (1994). A radiation hybrid map of human chromosome 18. Cytogenet. Cell. Genet. 66: 196-213.

Galibert F., Andre, C, Cheron, A., Chuat JC, Hitte, C, Jiang, Z., Jouquand, S., Priat, C, Renier, C, Vignaux, F. (1998). The advantages of the canine model in human genetics. Bull. Acad. Natle Mέd. 182: 81 1-822.

Guevara-Fujita, M ., Loechel, R., Nenta, P.J., Yuzbasiyan-Gurkan, N. and Brewer, G.J. Chromosomal assignment of seven genes on canine chromosomes by fluorescence in situ hybridization. Mamm. Genome 7: 268-270.

Gyapay, G., Schmitt, K., Fizames, C, Jones, H, Nega-Czarny, Ν., Spillett, D., Muselet, D., Prud'Homme, J.-F., Dib, C, Auffray, C. et al. (1996). A radiation hybrid map of the human genome. Hum.Mol.Genet. 5: 339-346.

Hayes, P.D., Schmitt, K., Jones, H.B., Gyapay, G., Weissenbach, J. and Goodfellow, P.Ν. (1996). Regional assignment of human ESTs by whole-genome radiation hybrid mapping. Mamm. Genome 7: 446-450.

Hόglund, M., Siden, T., Aman, P., Mandahl, Ν. and Mitelman, F. (1995). Isolation and characterization of radiation hybrids for human chromosome 12. Cytogenet.Cell.Genet. 69: 240-245.

Holmes, Ν.G., Humphreys, S.J., Binns, M.M., Curtis, R., Holliman, A. and Scott, A.M. (1993a). Isolation and characterization of microsatellites from the canine genome. Animal Genet. 24: 289-292.

Holmes, N.G., Humphreys, S.J., Binns, M.M., Curtis, R., Holliman, A. and Scott, A.M. (1993b). Characterization of canine microsatellites. DNA Fingerprinting : State of the Science 415-420. Holmes, N.G., Dickens, H.F., Parker, H.L., Binns, M.M., Mellersh, C.S. and Sampson, J. (1995). Eighteen canine microsatelhtes. Animal Genet. 26: 132-133.

Hudson, T.J., Stein, L.D., Gerety, S.S., Ma, J., Castle, A.B., Silva, J., Slonim, D.K., Baptista, R., Kruglyak, L., Xu, S.-H. et al. (1995). An STS-based map of the human genome. Science 270: 1945-1954.

Jiang, Z., Priat, C. and Galibert, F. (1998). Traced Orthologous Amplified Sequence Tags (TOASTs) and mammalian comparative maps. Mamm. Genome 9 : in press.

Johansson, M., Ellegren, H. and Andersson, L. (1995). Comparative mapping reveals extensive linkage conservation - but with gene order rearrangements - between the pig and the human genomes. Genomics 25: 682-690.

Kim, U.J., Shizuya, H, Kang, H.L., Choi, S.S., Garrett, C.L., Smink, L.J., Birren, B.W., Korenberg, J.R., Dunham, I. and Simon, M.I. (1996). A bacterial artificial chromosome- based framework contig map of human chromosome 22q. Proc.Natl.Acad.Sci. USA 93: 6297-6301.

Lachaume, P., Hitte, C, Jouquand, S., Priat, C. and Galibert, F. (1998). Identification and analysis of the dog keratine 9 (KRT9) gene. Animal Genet. 29: 1-5.

Langford, C.F., Fischer, P.E., Binns, M.M., Holmes, N.G. and Carter, N.P. (1996). Chromosome-specific paints from a high-resolution flow karyotype of the dog. Chromosome Res. 4: 115-123.

Langston, A.A., Mellersh, C.S., Neal, C.L., Ray, K., Acland, G.M., Gibbs, M., Aguirre, G.D., Fournier, R.E.K. and Ostrander, E.A. (1997). Construction of a panel of canine- rodent hybrid cell lines for use in partitioning of the canine genome. Genomics 46: 317- 325. Lingaas, F., Sorensen, A., Juneja, R.K., Johansson, S., Fredholm, M., Wintero, A.K., Sampson, J., Mellersh, C, Curzon, A., Holmes, N.G. et al. (1997). Towards construction of a canine linkage map: establishment of 16 linkage groups. Mamm. Genome 8: 218-221.

Lyons, L.A., Laughlin, T.F., Copeland, N.G., Jenkins, N.A., Womack, J.E. and O'Brien, S.J. (1997). Comparative anchor tagged sequences (CATS) for integrative mapping of mammalian genomes. Nature Genet. 15: 47-56.

Mariat, D., Kessler, J.L., Vaiman, D. and Panthier, J.J. (1996). Polymorphism characterization of five canine microsatellites. Animal Genet. 27: 433-442.

McCarthy, L.C. (1996). Whole genome radiation hybrid mapping. Trends Genet. 12: 491-493.

McCarthy, L.C, Terrett, J., Davis, M.E., Knights, C.J., Smith, A.L., ditcher, R., Schmitt, K., Hudson, J., Spurr, N.K. and Goodfellow, P.N. (1997). A first-generation whole genome-radiation hybrid map spanning the mouse genome. Genome Res.. 7: 1153-1161.

McPherson, J.D., Apostol, B., Wagner-McPherson, C.B., Hakim, S., Del Mastro, R.G., Aziz, N., Baer, E., Gonzales, G., Krane, M.C., Markovich, R. et al. (1997). A radiation hybrid map of human chromosome 5 with integration of cytogenetic, genetic, and transcript maps. Genome Res. 7: 897-909.

Mellersh, C.S., Langston, A.A., Acland, G.M., Fleming, M.A., Ray, K., Wiegland, N.A., Francisco, L.V., Gibbs, M., Aguirre, G.D. and Ostrander, E.A. (1997). A linkage map of the canine genome. Genomics 46: 326-336.

Molyneux, K. and Batt, R.M. (1994). Five polymorphic canine microsatellites. Animal Genet. 25: 379. O'Brien, S J , Womack, J E , Lyons, L A , Moore, K J , Jenkins, N A and Copeland, N G (1993) Anchored reference loci for comparative genome mapping in mammals Nature Genet. 3 103-112

O'Brien, S J , Cevario, S J , Martenson, J S , Thompson, M A , Nash, W G , Chang, E , Graves, J A M , Spencer, J A , Cho, K -W , Tsujimoto, H and Lyons, L A (1997a) Comparative gene mapping in the domestic cat (Fehs catus) J. Hered. 88 408-414

O'Brien, S J , Wienberg, J and Lyons, L A (1997b) Comparative genomics lessons from cats Trends Genet. 13 393-398

Ostrander, E A , Sprague, G F and Rine, J (1993) Identification and characterization of dinucleotide repeat (CA)n markers for genetic mapping in dog Genomics 16 207-213

Ostrander, E A , Mapa, F A , Yee, M and Rine, J (1995) One hundred and one new simple sequence repeat-based markers for the canine genome Mamm. Genome 6 192- 195

Ostrander, E A and Giniger, E (1997) Semper Fidelis what man's best friend can teach us about human biology and disease Am.J.Hum.Genet. 61 475-480

Raeymaekers, P , Van Zand, K , Jun, L , Hoglund, M , Cassiman, J -J , Van den Berghe, H and Marynen, P (1995) A radiation hybrid map with 60 loci covering the entire short arm of chromosome 12 Genomics 29 170-178

Reimann, N , Bartnitzke, S , Bullerdiek, J , Schmitz, U . Rogalla, P , Nolte, I and Ronne, M (1996) An extended nomenclature of the canine karyotype Cytogenet.Cell.Genet 73 140-144

Schelling, C , Stranzinger, G , Dolf, G , Schlapfer, J and Switonski, M Assignment of the canine microsatellite ZuBeCal to canine chromosome 10q22-q24 Animal Genet, in press Schlapfer, J., Yang, Y., Rexroadlll, C. and Womack, J.E. (1997). A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5: 511-519.

Schmitt, K., Foster, J.W., Feakes, R.W., Knights, C, Davis, M.E., Spillett, D.J. and Goodfellow, P.N. (1996). Construction of a mouse whole-genome radiation hybrid panel and application to MMU 11. Genomics 34: 193-197.

Schuler, G.D., Boguski, M.S., Stewart, E.A., Stein, L.D., Gyapay, G., Rice, R., White, R.E., Rodriguez-Tome, P., Aggarwal, A., Bajorek, E. et al. (1996). A gene map of the human genome. Science 274: 540-546.

Serpell, J. (1995). "The domestic dog : its evolution, behaviour and interactions with people" (Serpell, Ed.), Cambridge University Press, Cambridge.

Stewart, E.A., McKusick, K.B., Aggarwal, A., Bajorek, E., Brady, S., Chu, A., Fang, N., Hadley, D., Harris, M., Hussain, S. et al (1997). An STS-based radiation hybrid map of the human genome. Genome Res. 7: 422-433.

Switonski, M., Reimann, N., Bosma, A.A., Long, S., Bartnitzke, S., Pienkowska, A., Moreno-Milan, M.M. and Fischer, P. (1996). Report on the progress of standardization of the G-banded canine (Canis familiaris) karyotype. Chromosome Res.. 4: 306-309.

Switonski, M., Schelling, C, Dolf, G., Stranzinger, G. and Schlapfer, J. Assignment of the canine microsatellite ZuBeCa3 to canine chromosome 9q21-q22. Animal Genet, in press.

Thomas, R., Holmes, N.G., Fischer, P.E., Dickens, H.F., Breen, M., Sampson, J. and Binns, M.M. (1997). Eight canine microsatellites. Animal Genet. 28: 153-154. Venta, P J , Brouillette, J A , Yuzbasiyan-Gurkan,V and Brewer, G J (1996) Gene- specific universal mammalian sequence-tagged sites Application to the canine genome Biochem. Genet. 34 321-341

Vignaux, F , Priat, C , Jouquand, S , Hitte, C , Jiang, Z , Cheron, A , Renier, C , Andre, C and Galibert F Toward a dog radiation hybrid map J.Hered. in press

Walter, M A , Spillett, D J , Thomas, P , Weissenbach, J and Goodfellow, P N (1994) A method for constructing radiation hybrid maps of whole genomes Nature Genet. 7 22-28

Werner, P , Raducha, M G , Prociuk, U , Henthorn, P S and Patterson, D F (1997) Physical and linkage mapping of human chromosome 17 loci to dog chromosomes 9 and 5 Genomics 42 74-82

Womack, J E and Kapa, S R (1995) Bovine genome mapping evolutionary inference and the power of comparative genomics Curr.Opιn.Genet.Dev. 5 725-733

Womack, J E , Johnson, J S , Owens, E K , Rexroadlll, C E , Schlapfer, J and Yang, Y -P (1997) A whole-genome radiation hybrid panel for bovine gene mapping Mamm Genome 8 854-856

Yamada, J , Kuramoto, T and Serikawa, T A (1994) rat genetic linkage map and comparative maps for mouse or human homologous rat genes Mamm Genome 5 63- 83

Yang, Y -P , Rexroadlll, C E , Schlapfer, J and Womack, J E (1998) An integrated radiation hybrid map of bovine chromosome 19 and ordered comparative mapping with human chromosome 17 Genomics 48 93-99

Yuzbasiyan-Gurkan, web site http /_/www cvm msu edu/texi/res/cjmm Jbtm

Claims

1. Map of the dog genome comprising the genome location of a marker selected from the group consisting of the markers of sequence SEQ ID N° 1-804, as depicted in table 2.

2. Map according to claim 1 wherein it comprises the genome location of at least 50, 100, 200, 300 or preferably 400 markers selected from the group consisting of the markers of sequence SEQ ID N°l-804, as depicted in table 2.

3. Use of a map according to any one of claims 1 and 2 for identifying genes responsible for a phenotypic and behavioral trait of interest.

4. Use of a map according to any one of claims 1 and 2 for the identification of morbid genes.

5. Use of a map according to any one of claims 1 and 2 for analyzing diseases, for identifying the implicated genes of said diseases and their alleles.

6. Use of a map according to any one of claims 1 and 2 for studying dog pedigrees.

7. Use of a dog genome marker selected from the group consisting of the markers as depicted in table 2 of sequence SEQ ID N° 1-804, or sequence complementary thereto, for identifying genes responsible for a phenotypic and behavioral trait of interest.

8. Use of a dog genome marker selected from the group consisting of the markers as depicted in table 2 of sequence SEQ ID N° 1-804, or sequence complementary thereto, for the identification of morbid genes.

9. Use of a dog genome marker selected from the group consisting of the markers as depicted in table 2 of sequence SEQ ID N° 1-804, or sequence complementary thereto, for analyzing diseases, for identifying the implicated genes of said diseases and their alleles.

10. Use of a dog genome marker selected from the group consisting of the markers as depicted in table 2 of sequence SEQ ID N° 1-804, or sequence complementary thereto, for studying dog pedigrees.