WO2009070749A1

WO2009070749A1 - Dna aptamers

Info

Publication number: WO2009070749A1
Application number: PCT/US2008/085003
Authority: WO
Inventors: Srinand Sreevatsan
Original assignee: Regents Of The University Of Minnesota
Priority date: 2007-11-30
Filing date: 2008-11-26
Publication date: 2009-06-04

Abstract

The present invention relates to rapid diagnosis of Salmonella contamination using DNA aptamers.

Description

DNA APTAMERS

Priority of Invention

This application is related to and claims priority under 35 U.S. C. § 119(e) to U.S. Provisional Application No. 60/991 ,496 filed on November 30, 2007, which is incorporated by reference herein.

Government License

The U.S. Government has a paid-up license in this invention and the right in limited circumstances to require the patent owner to license others on reasonable terms as provided for by the terms of Grant No. 2004-1578-10 awarded by the United States Department of Agriculture.

Background of the Invention Salmonellae are a significant cause of food borne illnesses worldwide. For example, about 1.4 million cases of salmonellosis are reported annually in the US, with approximately 16,000 hospitalizations and 550 deaths. This organism alone is associated with 26% of all the food borne diarrheal cases leading to hospitalization. Of particular concern is salmonellosis caused by multidrug resistant (MDR) strains such as S. enterica serovar Typhimurium DT 104 or S. enterica serovar Newport. For example, drug resistant Salmonella Newport infections have emerged in US patients already on antimicrobial agent therapy and the primary source of the organism appears to be the domestic food supply, most notably beef and poultry. Furthermore, multiple drug resistant (MDR) Salmonella Typhimurium DT 104 incidence has increased in 29 industrialized nations between 1992 and 2001. Salmonellae are also important bacterial pathogens in food animal species including cows, pigs, chickens, turkeys, and pets. Among non-human cases, Salmonella Typhimurium is reported most frequently. Both classic zoonotic and more importantly, food borne transmission of Salmonella spp. have been well documented for these animal species. The organisms are shed in their feces sporadically and at undetermined levels, making prevention and control difficult. Thus their pre- and post-harvest detection and quantification is critical to obtain an improved understanding of shedding and transmission patterns, as well as for prevention and control of Salmonella contamination from food animal sources. Unfortunately, the detection of Salmonella and other pathogens in complex sample matrices such as a feces, foods, and environmental swabs and grab samples from animal houses is challenging for a number of reasons. First, time-consuming culturing and/or enrichment steps are almost always necessary to increase target copy number prior to the application of detection methods. Second, identification of Salmonella to the serovar level adds another layer of complexity. Although molecular techniques such as PCR can shorten time to detection, this technique has not allowed for the elimination of culturing and/or enrichment steps, largely because high levels of the target are still necessary because of the need for small amplification volumes (1-10 μl) in contrast to much larger sample volumes (1-25 or more grams or milliliters). In addition residual matrix-associated inhibitors oftentimes compromise molecular detection, impacting both assay sensitivity and specificity. Even the best currently described conventional direct animal fecal PCR or PCR on post enrichment samples have reproducible detection limits around 10,000 cfu/ml or above in spike-and recovery protocols. Thus, sensitive and specific pre-analytical sample processing methods are needed to enhance our ability to detect and quantify food borne pathogens from complex food and environmental samples.

Therefore, there is a need in the art for additional tests for detecting Salmonella contamination.

Summary of the Invention The present invention provides DNA aptamers, compositions and methods for detecting the presence of Salmonella in a sample. In one embodiment, the present invention provides a DNA aptamer 10 to 100 bases in length comprising a DNA binding sequence that is at least 95% identical to Aptamer 23 (SEQ ID NO:7), Aptamer 24 (SEQ ID NO:8), Aptamer 25 (SEQ ID NO:9), Aptamer 33 (SEQ ID NO:10) or Aptamer 45 (SEQ ID NO:11). The present invention provides a composition comprising a DNA aptamer operably linked to one or more entities.

The present invention further provides a method for detecting Salmonella in a sample comprising contacting the sample with a DNA aptamer as described herein or the composition as described herein to form bound Salmonella, and detecting the presence or the quantity of bound Salmonella.

Further provided by the present invention is a kit comprising a diagnostic test for detecting the presence of Salmonella comprising packaging material, containing, separately packaged, at least one DNA aptamer capable of forming a hybridized nucleic acid with Salmonella and instructions means directing the use of the DNA aptamer in accord with the methods of the invention.

Brief Description of Drawings

Figures IA and IB: Representative structures of the two DNA aptamers as derived by the MFOLD program show stem-loop structures. A: Aptamer 33 (SEQ ID NO: 15), B: Aptamer 45 (SEQ ID NO: 16).

Figure 2: Implementation of SELEX for the identification of aptamers against Salmonella Typhimurium OMP on a nitrocellulose lateral flow chromatography device.

Figures 3A-3C: DNase Footprint analysis of aptamer 33 with S. Typhimurium OMP: Aptamers synthesized with a 5' 6-FAM (carboxyfluorescein) were incubated with 4.5-μg S. Typhimurium OMP in a binding buffer at room temperature. The reactions were digested with 0.25 U DNase I for 9 min and then inactivated at 70°C for 10 min in a thermocycler. After purification with the Qiaquick Mini elute columns, the reactions were diluted 1:10 and subjected to fragment analysis in an Applied Biosystems 3130XL Genetic Analyzer. The data was analyzed using Gene Mapper v 4.0 software. Similar digestions and analysis were performed with control protein (BSA) for comparison with the S. Typhimurium OMP (A). Three- dimensional structure of aptamer 33 predicted by MFoId analysis. The region in the box represents the area of interaction with S. Typhimurium OMP (B). Chromatogram of aptamer 33 with the reactive sequence (SEQ ID NO: 17) indicated (C).

Figures 4A-4C: DNase Footprint analysis of aptamer 45 with S. Typhimurium OMP: Aptamers synthesized with a 5' 6-FAM (carboxyfluorescein) were incubated with 4.5-μg S. Typhimurium OMP in a binding buffer at room temperature. The reactions were digested with 0.25 U DNase I for 9 min and then inactivated at 70°C for 10 min in a thermocycler. After purification with Qiaquick Mini elute columns, the reactions were diluted 1:10 and subjected to fragment analysis in an Applied Biosystems 3130XL Genetic Analyzer. The data was analyzed using Gene Mapper v 4.0 software. Similar digestions and analysis were performed with control protein (BSA) for comparison with the S. Typhimurium OMP (A). Three dimensional structure of aptamer 45 predicted by Mfold analysis. The region in the box represents the area of interaction with S. Typhimurium OMP (B). Chromatogram of aptamer 45 with the reactive sequence (SEQ ID NO: 18) indicated (C). Figure 5: Detection limit (CFU/sample) vs. capture efficiency (CE, calculated as the ratio of DFU equivalent calculated by real-time PCR/sample to the total CFU inoculate/sample multiplied by 100) for aptamer 33 as applied to artificially contaminated chicken rinse samples.

Detailed Description of the Invention

Although new rapid test methods appear frequently, these almost always focus on the detection aspect and neglect the need for pre-analytical sample processing prior to detection. The fact remains that detection of pathogens in these complex matrices would be more sensitive if the agent were concentrated and purified from the matrix prior to detection. One important requirement to develop such pre-analytical sample processing is the availability of high affinity ligands that can aid in the selective capture and concentration of the pathogen.

Until recently, monoclonal and polyclonal antibodies were the most commonly used affinity ligands for pathogen capture. Aptamers, which are single stranded oligonucleotides that can naturally fold into different 3-dimensional structures, have the capability of binding specifically to biosurfaces. Aptamers against a specific target are generated using an iterative approach called SELEX (Systematic Evolution of Ligands by Exponential Enrichment) (Tuerk et al., Science 1990, 249:505-510) and have advantages over more antibodies in that they are inexpensive, stable, and can be synthetically manufactured and chemically manipulated with relative ease. They also can be generated quickly against multiple targets. Aptamers have been shown to be useful as therapeutic agents and diagnostic tools (Brody et al., J Biotechnol 2000, 74:5-13). In this study, the inventors used S. Typhimurium as a model organism to generate aptamers that can be used for capture and subsequent PCR-based detection of the organism from complex sample matrices.

There is a need for a ligand that has high specificity and avidity to whole Salmonella cells that allows for their capture and isolation from complex matrices at low numbers without selective pre-enrichment. The present inventors have developed ligands and methods useful in detecting Salmonella contamination of samples. Aptamers Aptamers are single stranded oligonucleotides that can naturally fold into different 3- dimensional structures, which have the capability of binding specifically to biosurfaces, target compound or moiety. The term "conformational change" refers to the process by which a nucleic acid, such as an aptamer, adopts a different secondary or tertiary structure. The term "fold" may be substituted for conformational change.

Aptamers have advantages over more traditional affinity molecules such as antibodies in that they are very stable, can be easily synthesized, and can be chemically manipulated with relative ease. Aptamer synthesis is potentially far cheaper and reproducible than antibody-based diagnostic tests. Aptamers are produced by solid phase chemical synthesis, an accurate and reproducible process with consistency among production batches. An aptamer can be produced in large quantities by polymerase chain reaction (PCR) and once the sequence is known, can be assembled from individual naturally occurring nucleotides and/or synthetic nucleotides. Aptamers are stable to long-term storage at room temperature, and, if denatured, aptamers can easily be renatured, a feature not shared by antibodies. Furthermore, aptamers have the potential to measure concentrations of ligand in orders of magnitude lower (parts per trillion or even quadrillion) than those antibody-based diagnostic tests. These characteristics of aptamers make them attractive for diagnostic applications. Aptamers are typically oligonucleotides that may be single stranded oligodeoxynucleotides, oligoribonucleotides, or modified oligodeoxynucleotide or oligoribonucleotides. The term "modified" encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleotides may also include T substituted sugars such as 2'-O-methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; T- S-allyl; 2'-fluoro-; 2'-halo or 2-azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose. Modified nucleotides are known in the art and include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil; 5-carboxymethylaminomethyl- 2-thiouracil; 5-carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; 1-methyladenine; 1-methylpseudouracil; 1-methylguanine; 2,2-dimethylguanine; 2- methyladenine; 2-methylguanine; 3-methylcytosine; 5-methylcytosine; N6-methyladenine; 7- methylguanine; 5-methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; .beta.-D- mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2-methylthio-N6- isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl- 2 thiouracil, 2-thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5-oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5- ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,- diaminopurine; methylpsuedouracil; 1 -methylguanine; 1-methylcytosine.

The aptamers of the invention are synthesized using conventional phosphodiester linked nucleotides and synthesized using standard solid or solution phase synthesis techniques which are known in the art. Linkages between nucleotides may use alternative linking molecules. For example, linking groups of the formula P(O)S, (thioate); P(S)S, (dithioate); P(O)NR'2; P(O)R'; P(O)ORO; CO; or CONR'2 wherein R is H (or a salt) or alkyl (1-12C) and R6 is alkyl (1-9C) is joined to adjacent nucleotides through — O~ or -S-. The binding of aptamers to a target polypeptide is readily tested by known assays. The present inventors have identified two Salmonella-specific aptamers with low-end detection limits at 10-40 CFU. These aptamers can be used as high affinity ligands for the sensitive capture and detection of Salmonella without prior pre-enrichment or culturing. The disclosed aptamers are capable of detecting multiple serovars of Salmonella.

In one embodiment, the present invention provides a DNA aptamer 10 to 100 bases in length comprising a binding sequence that is at least 95% identical to Aptamer 33 (SEQ ID NO:10) or Aptamer 45 (SEQ ID NO:11). The binding sequence binds to the target protein or Salmonella, hi certain embodiments, the DNA aptamer is from 40 to 96 bases in length. In certain embodiments, the DNA aptamer is 96 bases long. In certain embodiments, the binding sequence is identical to Aptamer 33 or Aptamer 45. In certain embodiments, the binding sequence is 40 to 96 bases long. In certain embodiments, the binding sequence is flanked by a first flanking sequence and a second flanking sequence. In certain embodiments, the first flanking sequence and the second flanking sequence are complementary to form a duplex. In certain embodiments, the first flanking sequence and the second flanking sequence are 1 to 35 bases in length. In certain embodiments, the first flanking sequence and the second flanking sequence are 4 to 28 bases in length.

The present invention provides a DNA aptamer consisting of Aptamer 33 (SEQ ID NO:1) or Aptamer 45 (SEQ ID NO:2). Compositions

The aptamers of the present invention can be operably linked to one or more entitites. hi certain embodiments, the entity is a fluorescent tag, affinity tag, a protein, a solid substrate, a cell surface, or a cellular component. In certain embodiments, the cellular component is a cell wall or cell membrane. In certain embodiments, the solid substrate is a component of silica, cellulose, cellulose acetate, nitrocellulose, nylon, polyester, polyethersulfone, polyolefin, or polyvinylidene fluoride, or combinations thereof. In certain embodiments, the solid substrate is a filter, magnetic bead, metal oxide, latex particle, microtiter plates, polystyrene bead, or CD- ROM. In certain embodiments, the DNA aptamer is linked to the entity by means of a linker. In certain embodiments, the linker is a binding pair. In certain embodiments, the "binding pair" refers to two molecules which interact with each other through any of a variety of molecular forces including, for example, ionic, covalent, hydrophobic, van der Waals, and hydrogen bonding, so that the pair have the property of binding specifically to each other. Specific binding means that the binding pair members exhibit binding to each other under conditions where they do not bind to another molecule. Examples of binding pairs are biotin-avidin, hormone-receptor, receptor-ligand, enzyme-substrate, IgG-protein A, antigen-antibody, and the like. In certain embodiments, a first member of the binding pair comprises avidin or streptavidin and a second member of the binding pair comprises biotin. In certain embodiments, the DNA aptamer is linked to the entity by means of a covalent bond. The entity, for example, may additionally or alternatively, be a detection means. A number of "molecular beacons" (such as fluorescence compounds) can be attached to aptamers to provide a means for signaling the presence of and quantifying a target chemical or biological agent. For instance, the inventors have identified aptamers specific for Salmonella. A fluorescence beacon, which quenches when Salmonella is reversibly bound to the aptamer, is used with a photodetector to quantify the concentration of Salmonella present. Aptamer-based biosensors can be used repeatedly, in contrast to antibody-based tests that can be used only once. Examples of molecular beacons are amplifying fluorescent polymers (AFP). Other exemplary detection labels that could be attached to the aptamers include biotin, any fluorescent dye, amine modification, horseradish peroxidase, alkaline phosphatase, etc. In certain embodiments, the aptamer is operably linked to a detection means and to a solid substrate. For example, the aptamer may be linked to a fluorescent dye and to a magnetic bead. Detection and Amplification Methods

The present invention provides methods for detecting Salmonella in a sample comprising contacting the sample with a DNA aptamer as described herein or the composition as described herein to form bound Salmonella, and detecting the presence or the quantity of bound Salmonella. In certain embodiments, the method is sufficiently sensitive to detect 10-40 organisms/gm of sample. In certain embodiments, the bound Salmonella is detected by means of PCR, nuclear magnetic resonance, fluorescent capillary electrophoresis, lateral flow devices, colorimetry, chemiluminescence, fluorescence, South-western blots, microarrays, or ELISA. In certain embodiments, the sample is not concentrated or pre-enriched. As used herein, the term "not concentrated" or "pre-enriched" means that the sample is not processed prior to being subjected to the analyzing method of the present invention. In certain embodiments, the detection step is completed in less than 24 hours, less than 18 hours, less than 12 hours, or even less than 6 hours.

In certain embodiments, the sample is a physiological sample, a food sample, a liquid sample, or an environmental sample. In one embodiment of the invention, the method involves obtaining a physiological sample from an animal. As used herein, the phrase "physiological sample" is meant to refer to a biological sample that may contain Salmonella obtained from an animal. In certain embodiments, the physiological sample is an animal secretion or excretion. In certain embodiments, the liquid sample is milk, juice, water, carcass wash, or vegetable wash. In certain embodiments, the food sample is a meat sample. In certain embodiments, the method detects whole Salmonella cells. As used herein, the term "whole Salmonella cells" is used to mean that the cells are intact, and have not been lysed prior to being subjected to the method of the present invention.

In one embodiment of the present invention, the method also involves contacting the sample with at least one aptamer to form a hybridized nucleic acid and detecting the hybridized nucleic acid. In one embodiment, the detection is by amplification. "Amplifying" utilizes methods such as the polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR), strand displacement amplification, nucleic acid sequence-based amplification, and amplification methods based on the use of Q-beta replicase. These methods are well known and widely practiced in the art. Reagents and hardware for conducting PCR are commercially available. In one embodiment of the present invention, at least one type of aptamer is immobilized on a solid surface. The methods of the present invention can be used to detect the presence of Salmonella in a sample.

According to the methods of the present invention, the amplification of DNA present in a physiological sample may be carried out by any means known to the art. Examples of suitable amplification techniques include, but are not limited to, polymerase chain reaction (including, for RNA amplification, reverse-transcriptase polymerase chain reaction), ligase chain reaction, strand displacement amplification, transcription-based amplification, self-sustained sequence replication (or "3SR"), the Qβ replicase system, nucleic acid sequence-based amplification (or "NASBA"), the repair chain reaction (or "RCR"), and boomerang DNA amplification (or "BDA").

The bases incorporated into the amplification product may be natural or modified bases (modified before or after amplification), and the bases may be selected to optimize subsequent electrochemical detection steps.

Polymerase chain reaction (PCR) may be carried out in accordance with known techniques. See, e.g., U.S. Patent Numbers 4,683,195; 4,683,202; 4,800,159; and 4,965,188. In general, PCR involves, first, treating a nucleic acid sample {e.g., in the presence of a heat stable DNA polymerase) with one oligonucleotide primer for each strand of the specific sequence to be detected under hybridizing conditions so that an extension product of each primer is synthesized that is complementary to each nucleic acid strand, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith so that the extension product synthesized from each primer, when it is separated from its complement, can serve as a template for synthesis of the extension product of the other primer, and then treating the sample under denaturing conditions to separate the primer extension products from their templates if the sequence or sequences to be detected are present. These steps are cyclically repeated until the desired degree of amplification is obtained. Detection of the amplified sequence may be carried out by adding to the reaction product an oligonucleotide probe capable of hybridizing to the reaction product {e.g., an oligonucleotide probe of the present invention), the probe carrying a detectable label, and then detecting the label in accordance with known techniques. Where the nucleic acid to be amplified is RNA, amplification may be carried out by initial conversion to DNA by reverse transcriptase in accordance with known techniques.

Strand displacement amplification (SDA) may be carried out in accordance with known techniques. For example, SDA may be carried out with a single amplification primer or a pair of amplification primers, with exponential amplification being achieved with the latter. In general, SDA amplification primers comprise, in the 5' to 3' direction, a flanking sequence (the DNA sequence of which is noncritical), a restriction site for the restriction enzyme employed in the reaction, and an oligonucleotide sequence (e.g., an oligonucleotide probe of the present invention) that hybridizes to the target sequence to be amplified and/or detected. The flanking sequence, which serves to facilitate binding of the restriction enzyme to the recognition site and provides a DNA polymerase priming site after the restriction site has been nicked, is about 15 to 20 nucleotides in length in one embodiment. The restriction site is functional in the SDA reaction. The oligonucleotide probe portion is about 13 to 15 nucleotides in length in one embodiment of the invention.

Ligase chain reaction (LCR) is also carried out in accordance with known techniques. In general, the reaction is carried out with two pairs of oligonucleotide probes: one pair binds to one strand of the sequence to be detected; the other pair binds to the other strand of the sequence to be detected. Each pair together completely overlaps the strand to which it corresponds. The reaction is carried out by, first, denaturing (e.g., separating) the strands of the sequence to be detected, then reacting the strands with the two pairs of oligonucleotide probes in the presence of a heat stable ligase so that each pair of oligonucleotide probes is ligated together, then separating the reaction product, and then cyclically repeating the process until the sequence has been amplified to the desired degree. Detection may then be carried out in like manner as described above with respect to PCR.

Diagnostic techniques that are useful in the methods of the invention include, but are not limited to direct DNA sequencing, PFGE analysis, allele-specific oligonucleotide (ASO), dot blot analysis and denaturing gradient gel electrophoresis, and are well known to the artisan.

The sample may be contacted with the aptamer in any suitable manner known to those skilled in the art. For example, the sample may be solubilized in solution, and contacted with the aptamer by solubilizing the aptamer in solution with the sample under conditions that permit binding. Suitable conditions are well known to those skilled in the art. Alternatively, the sample may be solubilized in solution with the aptamer immobilized on a solid support, whereby the sample may be contacted with the aptamer by immersing the solid support having the aptamer immobilized thereon in the solution containing the sample.

General Terminology "Synthetic" aptamers are those prepared by chemical synthesis. The DNA aptamers may also be produced by recombinant DNA methods. "Recombinant DNA molecule" is a combination of DNA sequences that are joined together using recombinant DNA technology and procedures used to join together DNA sequences as described, for example, in Sambrook and Russell (2001). As used herein, the term "nucleic acid" and "polynucleotide" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double- stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base that is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues.

A "nucleic acid fragment" is a portion of a given nucleic acid molecule. Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term "nucleotide sequence" refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.

The terms "nucleic acid," "nucleic acid molecule," "nucleic acid fragment," "nucleic acid sequence or segment," or "polynucleotide" may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene, e.g., genomic DNA, and even synthetic DNA sequences. The term also includes sequences that include any of the known base analogs of DNA and RNA. A "variant" of a molecule is a sequence that is substantially similar to the sequence of the native molecule. For nucleotide sequences, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Naturally occurring allelic variants such as these can be identified with the use of well- known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis that encode the native protein, as well as those that encode a polypeptide having amino acid substitutions. Generally, nucleotide sequence variants of the invention will have in at least one embodiment 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the native (endogenous) nucleotide sequence.

The term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Genes include coding sequences and/or the regulatory sequences required for their expression. For example, gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or a specific protein, including its regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters. In addition, a "gene" or a "recombinant gene" refers to a nucleic acid molecule comprising an open reading frame and including at least one exon and (optionally) an intron sequence. The term "intron" refers to a DNA sequence present in a given gene which is not translated into protein and is generally found between exons. "Naturally occurring," "native" or "wild type" is used to describe an object that can be found in nature as distinct from being artificially produced. For example, a nucleotide sequence present in an organism (including a virus), which can be isolated from a source in nature and which has not been intentionally modified in the laboratory, is naturally occurring. Furthermore, "wild-type" refers to the normal gene, or organism found in nature without any known mutation. "Homology" refers to the percent identity between two polynucleotides or two polypeptide sequences. Two DNA or polypeptide sequences are "homologous" to each other when the sequences exhibit at least about 75% to 85% (including 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, and 85%), at least about 90%, or at least about 95% to 99% (including 95%, 96%, 97%, 98%, 99%) contiguous sequence identity over a defined length of the sequences.

The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence," (b) "comparison window," (c) "sequence identity," (d) "percentage of sequence identity," and (e) "substantial identity."

(a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.

(b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.

Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.

Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (see the World Wide Web at ncbi.nlm.nih.gov). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.

In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, less than about 0.01, or even less than about 0.001. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. When using BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M = 5, N = -4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See the World Wide Web at ncbi.nlm.nih.gov. Alignment may also be performed manually by visual inspection. For purposes of the present invention, comparison of nucleotide sequences for determination of percent sequence identity to the sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by a BLAST program. (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection. When percentage of sequence identity is used in reference to proteins, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).

(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. (e)(i) The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%; at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%; at least 90%, 91%, 92%, 93%, or 94%; or even at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.

Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions (see below). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 1°C to about 20⁰C, depending upon the desired degree of stringency as otherwise qualified herein. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.

(e)(ii) For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

As noted above, another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence. "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. The T_n, is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched nucleic acid. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA- DNA hybrids, the T_m can be approximated from the equation of Meinkoth and Wahl: T_m 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. T_m is reduced by about 1°C for each 1% of mismatching; thus, T_m, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T_n, can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T_m) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (T_m); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (T_m); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (T_m). Using the equation, hybridization and wash compositions, and desired T, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. Generally, highly stringent hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH.

An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent wash conditions is a 0.2X SSC wash at 65°C for 15 minutes. Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is IX SSC at 45⁰C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6X SSC at 40⁰C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C and at least about 60°C for long probes (e.g., >50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.

Very stringent conditions are selected to be equal to the T_m for a particular probe. An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, IM NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (2OX SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.

"Operably-linked" nucleic acids refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other, e.g., an arrangement of elements wherein the components so described are configured so as to perform their usual function. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation. Control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter and the coding sequence and the promoter can still be considered "operably linked" to the coding sequence. As discussed above, the terms "isolated and/or purified" refer to in vitro isolation of a nucleic acid, e.g., a DNA or RNA molecule from its natural cellular environment, and from association with other components of the cell, such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and/or expressed. For example, "isolated nucleic acid" may be a DNA molecule that is complementary or hybridizes to a sequence in a gene of interest and remains stably bound under stringent conditions (as defined by methods well known in the art). Thus, the RNA or DNA is "isolated" in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA and in one embodiment of the invention is substantially free of any other mammalian RNA or DNA. The phrase "free from at least one contaminating source nucleic acid with which it is normally associated" includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell, e.g., in a vector or plasmid.

As used herein, the term "recombinant nucleic acid," e.g., "recombinant DNA sequence or segment" refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from any appropriate cellular source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in a genome that has not been transformed with exogenous DNA. An example of preselected DNA "derived" from a source would be a DNA sequence that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form. An example of such DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g. , by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.

Thus, recovery or isolation of a given fragment of DNA from a restriction digest can employ separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. Therefore, "recombinant DNA" includes completely synthetic DNA sequences, semi-synthetic DNA sequences, DNA sequences isolated from biological sources, and DNA sequences derived from RNA, as well as mixtures thereof. Nucleic acid molecules having base substitutions (i.e., variants) are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non- variant version of the nucleic acid molecule.

The terms "protein," "peptide" and "polypeptide" are used interchangeably herein. As used herein, the terms "a" or "an" are used to mean "one or more."

Example 1

Sensitive and specific preanalytical sample processing methods are needed to enhance the ability to detect and quantify foodborne pathogens from complex food and environmental samples. In this study DNA aptamers were selected and evaluated for the capture and detection of Salmonella enterica serovar Typhimurium using a magnetic bead-based protocol. A total of 66 candidate DNA sequences bound were to bind S. Typhimurium outer membrane proteins (OMPs) and counter-selection against Escherichia coli OMPs and lipopolysaccharides (LPS) of S. Typhimurium OMP. Five S. Typhimurium-specific aptamer candidates were identified for further characterization. A dilution-to-extinction capture protocol using Salmonella cultures identified two candidates (aptamer 33 and aptamer 45) (Figs. IA and IB) with low-end detection limits at 10 CFU/gm. Real time PCR of a segment of the invasin gene (invA) and a S. Typhimurium-specific target were used to analyze the DNA isolated from bead-bound cells after capture. Reproducible detection at the level of <10 S. Typhimurium CFU/g was achieved in spike-and-recovery experiments using bovine feces. Further, the DNase protection assay as applied to the two aptamers confirmed sequence-specific binding to S. Typhimurium OMP preparations. This is the first report where aptamers have been used as high affinity ligands for rapid pre-analytical processing of complex matrices for pathogens. Materials and Methods

The initial aptamer library was screened by SELEX, candidate binders purified, and binding affinity characterized in a single laboratory (Laboratory A). Thereafter, candidate aptamer(s) were tested for their ability to capture S. Typhimurium using protocols developed by two independent laboratories (Laboratory A and Laboratory B).

Bacterial strains and field isolates: Salmonella enterica serovars Typhimurium PTlO, Dublin, Enteritidis, Fresno, Hadar, Javiana, Moscow, Newport and generic Escherichia coli were obtained from the collections of Dr. K. V. Nagaraja, Veterinary and Biomedical Sciences Department, University of Minnesota, St Paul, MN. Freezer stocks were revived on Brilliant Green agar and 2-4 colonies were picked for subculture in BHI broth for all downstream analyses.

A total of 6 chicken litter samples were obtained from an ongoing Salmonella surveillance project at the University of Minnesota. Of these, 3 were positive for Salmonellae and 3 tested negative by conventional enrichment and selective culture methods. Most probable numbers (MPN) in 2 samples were 9/gm of litter. The third sample was a low positive with an MPN of2/gm.

Isolation of outer membrane proteins from various Salmonella serovars and different Enterobacteriacae species: Outer membrane proteins (OMPs) were isolated as follows. Briefly, actively growing cultures were harvested after 3 h of growth in Brain Heart

Infusion (BHI) medium (BD Biosciences, Sparks, MD) by centrifugation at 1800 X g for 30 min at 4 °C, followed by washing twice with IX phosphate buffered saline (PBS) and re-suspended in 10-mM HEPES buffer containing 2% sodium dodoecyl sulphate (SDS) or 3% empigen. The cells were then subjected to 5 iterations of repeated freeze-thaw lysis using a combination of liquid nitrogen followed by boiling. The lysate was subjected to a low speed spin at 1800 X g for 10 min at 4 ⁰C to remove whole cells and cellular debris. The pellet was discarded and the supernatant was designated the crude membrane preparation. For further purification, the crude membrane fraction was ultracentrifuged at 100,000 X g for 1 h at 4 ⁰C. The supernatant was discarded and the pellet was incubated in 10 mM HEPES buffer with 1% SDS or 1% empigen for 1 h at room temperature until completely dissolved. This suspension was re-centrifuged at 100,000 X g for 1 h at 4 °C and the pellet was collected and dissolved in a membrane solubilization buffer containing 100 mM HEPES, 50 mM sodium chloride. The protein content of the membrane extracts was estimated using the BCA protein assay kit (Pierce Biotechnology, Milwaukee, WI). Both the crude and purified OMP preparations were subjected to Benzonase® Nuclease (Novagen, Madison, WI) treatment to remove residual nucleic acids that might interfere with the SELEX process. Benzonase® Nuclease was inactivated by treating the preparation with 5mM EDTA and incubation at 70 ⁰C for 10 min. The protein preparation was resolved and analyzed on a 10% SDS-PAGE. In case of E. coli, the freeze thaw lysate was used as a crude OMP preparation. Aptamers and primers: Aptamers were selected from a 40-mer randomized library which had the following 28-mer primer overhang sequences: 5'- TTTGGTCCTTGTCTT ATGTCC AGAATGC-3' (SEQ ID NO:1) and 5'- ATTTCTCCTACTGGGATAGGTGGATTAT-S' (SEQ ID NO:2) on the 5' and 3' ends respectively. All the primers and aptamers used in this study were synthesized by IDT Technologies Inc, Coralville, IA.

Identification of aptamer candidates using Systematic Evolution of Ligands by Exponential Enrichment (SELEX): Aptamer candidates were selected against S. Typhimurium purified OMP using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) protocol as previously described (Hoorfar et al. (2000) J CHn Microbiol, 38, 3429-3435) with the following modifications. A lateral flow chromatography device, which was a nitrocellulose membrane with an aptamer release pad at one end and a wicking pad at the other end, was used for SELEX (Fig. 2). Briefly, 30 ng of the purified S. Typhimurium OMP was used in SELEX. A 1% PBS-Bovine Serum Albumin (BSA)-Tween 20 (PBS-Tn) buffer was used as the blocking and dilution agent throughout the protocol. The aptamer library was pre-incubated with IX PBS/1%BSA for 10 min at room temperature, loaded on the aptamer release pad and allowed to flow through the membrane. The library was allowed to contact the target by chromatographic flow with IX PBS-Tn on the aptamer release pad. Non-specific and low affinity candidates bound to S. Typhimurium OMP were washed four times with a high stringency buffer (Caps 8.86 g, KSCN 46.65 g, NaN₃, 0.8 g, Triton X 100, 82.5g, 25 X PBS 160 ml, distilled water 3800 ml adjusted to pH 7.6 with ION NaOH and made up to 4 L and filter sterilized). For counter SELEX, the aptamer library was exposed to a mix of E. coli crude OMP and LPS (Sigma, St Louis, MO) before exposure to the Salmonella OMP target.

A total of seven iterations of SELEX were performed: four directed against S. Typhimurium OMP and three rounds of counter-SELEX directed against E. coli and Salmonella LPS (Sigma -Aldrich Inc, St Louis, MO) as negative selection receptors. Candidate sequences in the seventh SELEX were collectively termed the SELEX "pool" and used in the evaluation of individual aptamers and as a collective capture reagent in downstream assays.

Cloning and sequencing of candidate aptamers: The selected aptamer pool at the end of seven rounds of SELEX was cloned using the TOPO® TA Cloning® Kit per manufacturer protocol (Invitrogen™, Carlsbad, CA). Transformants with inserts were selected using blue/white screening on LB plates containing ampicillin and 5-bromo-4-chloro-3-indolyl-β- galactopranoside (X-gal). The plasmid was isolated from all transformants using a plasmid mini prep kit (QIAGEN^®, Valencia, CA) and sequenced at the Biomedical genomics center, University of Minnesota, St. Paul, MN. Electrophoretic Mobility shift analysis (EMSA): The EMSA light shift chemiluminiscence kit (Pierce Biotechnology) was used for gel-shift analysis. The reaction used 0.6 ng of the biotinylated aptamer and 6.0 μg of the protein. The reactions were incubated at room temperature for 1 h and electrophoresed on a 0.5X TBE-6% non-denaturing polyacrylamide gel. The DNA was transferred onto a nylon membrane and EMSA visualized by a chemiluminiscence detector as per the instructions of the kit.

South-Western Blot analysis: OMPs were resolved on a 12% SDS-PAGE and the proteins were transferred on to a nitrocellulose membrane at 60 V for 2 h in a buffer containing 25.2 mM Tris, 192 mM glycine, 10% methanol and 0.1% SDS. Membranes were then blocked with IX PBS-Tween 20/1% BSA for 1 hr and reacted with specific aptamer candidates or the SELEX pool (100-ng) in the blocking solution for 1 h. The membranes were washed with IX PBS-Tween four times for 1 h. The membranes were then incubated in NeutrAvidin- horseradish peroxidase (HRP) - blocking solution conjugate (1: 10000 dilution) for 1 h and washed with IX PBS-Tween four times for 1 h. Later, they were developed with 3.3', 5.5'- tetramethylbenzidine (TMB) substrate (KPL Biotechnologies Inc, Gaithersburg, MD).

Mass Spectrometry: Corresponding positive bands on the South-Western blots were excised from Coomassie Blue-stained gels and analyzed by mass spectrometry at the Proteomics facility of the University of Minnesota, St Paul, MN. The protocol was as follows. Briefly, protein bands were subjected to two series of dehydration and hydration steps by the addition, incubation and removal of acetonitrile followed by the addition, incubation and removal of 25 mM NH₄HCO₃. Gel bands were then subjected to tryptic digestion with 12ng/μl trypsin (Promega, Madison, WI) in 25 mM NH₄HCO₃, 5 mM CaCl₂ at 37° for 10 h. The reaction was stopped with the addition of formic acid to a final concentration of 0.1%. Sample digests were manually aspirated and dispensed into 1.5 ml tubes with subsequent extraction by two rounds of addition, incubation and removal to respective tubes of 60% acetonitrile, 0.1% formic acid. All digestion extracts were dried in a ThermoSavant SC210A SpeedVac^® Plus, resuspended in LC- MS/MS loading buffer (98% H₂O, 2% acetonitrile and 0.1% formic acid). Samples were injected in a Michrom Bioresources Paradigm 2D capillary LC system (Michrom Bioresources, Inc, Auburn, CA) online with a linear ion trap (LTQ, Thermo Electron Corp., San Jose, CA). Peptides were desalted and concentrated on a Paradigm Platinum Peptide Nanotrap (Michrom Bioresources, Inc.) precolumn (0.15 x 50 mm, 400-μl volume) and subsequently to fused silica microcapillary columns (75 μm internal diameter, 13 cm in length, Magic Cl 8 AQ reversed- phase material (Michrom Bioresources, Inc.), packed in-house, at a flow rate of approximately 250 nL/min. The samples were subjected to a 60 min (10-40% ACN) gradient and directly eluted into the microcapillary column set to 2.0 kV. The LTQ was operated in the positive-ion mode using data-dependent acquisition methods initiated by a survey MS scan which was followed by MS/MS (collision energy of 35%) on the 4 most abundant ions detected in the survey scan. M/Z values selected in the survey scan for MS/MS were excluded for subsequential MS/MS with a dynamic exclusion from further data-dependent MS/MS for 30 sec. The signal intensity threshold for an ion to be selected for MS/MS was set to a lower limit of 1000. Database Searching: All MS/MS samples were analyzed using Sequest (Bio Works™ version 3.3 ThermoFinnigan, San Jose, CA) and X! Tandem (on the world-wide-web at thegpm.org). The search used a FASTA Salmonella NCBI 110806 contaminant combined library containing more than 82756 proteins including known contaminants. The Sequest search parameters were: fixed for carbamidomethyl modification of cysteine and differential for oxidation of methionine with 2 trypsin miscleavaged sites allowed. Scaffold (version Scaffold- 01 05 14, Proteome Software Inc., Portland, OR) was used to validate MS/MS-based peptide and protein identifications.

Criteria for Protein Identification: Peptide identifications were accepted if they could be established at greater than 95% probability with 3 unique peptides as specified by the Sequest and xTandem algorithm. Proteins of interest identified by less than three peptides were examined manually by evaluation of the raw spectra to establish inclusion. Manual determination consisted of assigning peaks that were unassigned by the automated search methods and determining all assigned peaks intensities were above an established noise level. Proteins meeting search parameters and possessing assignable peaks were included in the data. Surface PIasmon Resonance: Aptamer 33 and Aptamer 45 binding kinetics with S.

Typhimurium OMP were analyzed using a Reichert SR Dual Channel 7000 spectrometer. 5'- amine modified aptamers were immobilized on the flow cells 1 and 2. S. Typhimurium OMP was used as the analyte. Control lanes were coated with S. Typhimurium OMP alone. First the binding of S. Typhimurium OMP to the aptamer was analyzed. Later the binding of OMP of closely related enterobacteria, Enterobacter aerogenes, Shigella flexnerii and Klebsiella pneumoniae were also evaluated. Finally a mixture of two, i.e., S. Typhimurium OMP and one enterobacterial OMP was evaluated as an analyte. DNase Footprint assay: The DNase footprint assay was performed as follows. The aptamers were synthesized with a 5' 6-carboxy- fluorescein (FAM). A 4.5 μg aliquot of S. Typhimurium OMP was incubated with 2 μL of binding buffer (EMSA Light Shift™ Kit, Pierce Biotechnology, Rockford, IL) to which was added 150 ng of the 6FAM-labeled single stranded aptamer in a 50-μL reaction. The above reaction mix was incubated with 0.25 U of DNase (Ambion® Inc, Austin, TX) for 7 and 9 min at 37 °C followed by a 10 min of DNase inactivation done at 70 °C in a thermocycler (Eppendorf, Westbury, NY). Control digestions were performed with 4.5 μg of BSA in the absence of either protein. The reactions were purified using the QIAquick^® Mini elute kit (QIAGEN^®). Serial 10-fold dilutions of these purified reactions were submitted for fragment analysis on a 3130XL Genetic Analyzer (Applied Biosystems, Foster City, CA). The data were analyzed using GeneMapper^® Software, ver. 4.0 (Applied Biosystems) accessed through the University of Minnesota Supercomputing Center. Production of aptamer-conjugated paramagnetic beads: A 0.4 nmol aliquot of the synthesized single stranded biotinylated aptamers 33 and 45 was coupled to 200-300 μL streptavidin coated magnetic beads (Promega®, Madison, WI) in IX PBS after the beads were washed and prepared as per manufacturer instructions. These were subsequently used in the capture assays.

Capture of Salmonella^ from sample matrices using aptamer conjugated paramagnetic beads: Two laboratories evaluated the aptamer-conjugated beads for & Typhimurium capture and subsequent detection by PCR in different sample matrices; Laboratory A evaluated buffer and a fecal matrix, while Laboratory B evaluated S. Typhimurium-seeded chicken rinse samples processed using a magnetic pull down procedure and a recirculating magnetic capture device. The methods employed by each laboratory differed slightly and are detailed below. Protocols for Laboratory A: Actively growing cultures of a multidrug resistant strain of

S. Typhimurium were pelleted, washed twice in IX PBS, and 10-fold serial dilutions were done in IX PBS. A 200-μL aliquot of beads was added to 5 ml aliquots with repeated pipetting at room temperature for 2 min to promote mixing. The beads were washed 4 times by resuspension/capture using a 2.0 mL capacity magnetic particle concentrator (Dynal MPC®-S magnetic particle concentrator for eppendorf microtubes, Dynal A.S, Oslo, Norway) in IX PBS- Tween 20 solution after which they were resuspended in 200-μL IX PBS. Bovine fecal samples, confirmed by culture as Salmonella negative were spiked with <100 CFU of pure culture of S. Typhimurium and processed for capture using the aptamer-conjugated beads. Briefly, 1 g of a fecal suspension diluted 10-fold in IX PBS was vortexed, sonicated for 1 min in a sonicator (Branson Cleaning Equipment Company, Shelton, CT) at room temperature, vortexed again and spun at 976 X g for 30 sec. The supernatant was collected and 200-μL of the beads was added. The solution was then processed for aptamer capture as described above.

DNA was extracted from the entire magnetic bead volume using the Qiagen® stool kit (Qiagen®) with minor modifications of manufacturer's instructions. Two different PCR approaches were used by Laboratory A. In the first (genus-specific), a SYBR green-based realtime PCR targeting the invA gene of Salmonella [left primer 5'- TCGTC ATTCCATTACCTACC-3' (SEQ ID NO:3) and right primer 5'-

AAACGTTGAAAAACTGAGGA-3' (SEQ ID NO:4)] was used. The reaction volume was 35- μL and consisted of IX QuantiTect® SYBR Green PCR master mix, 6.5-mM MgCl₂, 0.6-μM of each primer, 10-μg of BSA, and 10-μL of DNA template. Thermal cycling conditions were as follows: initial denaturation for HotStart activation at 95 °C for 15 min, followed by 50 cycles each of 95 °C for 15 sec, 55 °C for 15 sec, and 72 °C for 45 sec. The 119-bp amplicons were identified by melting curve analysis (denaturation at 95 °C for 15 sec followed by a 1 min annealing step at 60 °C and a ramp up to max of 95 °C). Based on previously reported DNA sequences and amplification protocols unique to S. Typhimurium (Kim et al., J Food Prot 2006, 69:1653-1661) the STM4497 non-annotated sequence was further analyzed by Primer 3 software online and primers developed to amplify a smaller (114-bp) region that could be applied to for species-specific detection. NCBI BLAST analysis ruled out sequence homology to any related bacterial DNA and when screened against 8 different Salmonella serovars [S. Dublin, S. Enteritidis, S. Fresno, S. Hadar, S. Javiana, S. Moscow, S. Newport, S. Typhimurium], the assay was specific for S. Typhimurium. The 50-μL amplification reaction consisted of 1OX PCR buffer, 5-mM MgCl₂, 0.2-μM primers [Sty Spec primer F (5'

TGCTC ACTGAACGTGGGTTA3' (SEQ ID NO:5)) and Sty Spec primer R (5' AATCCGCGATCTTTTTCTGA 3' (SEQ ID NO:6))], 0.2-μM dNTPs, 10-μL template and 0.25 U Hotmaster Taq DNA polymerase (Eppendorf, Westbury, NY). Thermocycling conditions were as follows: 95 °C for 3 min followed by 10 cycles of 95 ⁰C for 30 sec, 50 °C for 30 sec, 72 ⁰C for 30 sec. This was followed by 25 cycles of 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 30 sec, with a final extension at 72 °C for 7 min. AU amplifications were done using an Applied Biosystems 7500 real-time PCR machine (Foster City, CA). Protocols for Laboratory B: Whole carcass chicken rinse was prepared in Buffered Peptone Water (BPW) from procured frozen whole chicken as per the standards of the United States Department of Agriculture. Chicken rinse was autoclaved for 20 min at 121 °C and 50 μL plated onto the Trypticase™ Soy agar (TSA) to confirm sterility. A naturally occurring multidrug resistant S. Typhimurium strain (same as the one used in laboratory A) was used for artificial contamination of chicken carcass rinse.

Sterile chicken rinse was inoculated with S. Typhimurium cells (10:1, v/v) grown overnight in BBL™ Trypticase™ Soy broth having 0.5-mg ampicillin (TSB-A). This initial suspension provides a concentration of approx 10⁷-10⁸ CFU S. Typhimurium/mL). Ten-fold serial dilutions of this stock were made in sterile chicken rinse to obtain a range of 10¹-10⁵ CFU/mL chicken rinse.

For the magnetic pull-down assay, 9 ml each serially dilution chicken rinse sample was seeded with a 250 μl aliquot of the aptamer-coupled magnetic beads followed by shaking on a waver (VWR, Batavia, IL) for 30 min at room temperature. The aptamer coupled magnetic beads were pulled down using the Dynal MPC®-M magnetic particle concentrator for eppendorf microtubes (Dynal A.S, Oslo, Norway) and the supernatant was discarded. Magnetic beads were washed four times with IX PBS-0.05% Tween20 buffer and then dissolved in 200 μL of IX PBS.

For the recirculation capture assay, 25 mL of each chicken rinse samples diluted 10-fold in 225mL sterile BPW in Whirl-Pak filter bags (Nasco, Fort Atkinson, WI). The filter bags were loaded onto the Pathatrix™ machine (Pathatrix™; Matrix MicroScience Ltd., UK). The closed circuit disposable filtering apparatus was installed with the suction end placed in the filter bag and the tube passing over the external magnetic capture section. A 300 μL volume of aptamer- bound beads was loaded in the filtering apparatus tube. Each chicken rinse sample was circulated for 30 min at room temperature by peristaltic pump during which the entire volume of the sample was re-circulated across the capture magnet. Upon completion of the re-circulation capture, the magnetic beads were washed in BPW with recirculation. The disposable filter apparatus was removed, beads were collected, further washed 4 more times in IX PBS-0.05% Tween-20 buffer with gentle agitation, and then reconstituted in 200 μL of IX PBS for DNA isolation.

The DNA was extracted from magnetic beads using the NucleoSpin^® Food genomic DNA extraction kit (Macherey-Nagel, Dϋren, Germany) as per manufacture's protocol with minor modifications. Specifically after lysis of bead-bound Salmonella cells, 500-μl of the clear supernatant was transferred and an equal volume of buffer C4 and ethanol were added. After vortexing for 30 sec, the mixture was passed though the NucleoSpin^® Food columns and DNA was eluted in 35-μl of proprietary elution buffer. DNA amplification was done by real-time PCR using primers (Forward 5'- GTG AAA

TTA TCG CCA CGT TCG GGC AA - 3' (SEQ ID NO: 12); Reverse 5' - TCA TCG CAC CGT CAA AGG AAC C - 3' (SEQ ID NO: 13)) complementary to 285 bp region of invA gene of Salmonella and a Taqman probe (5' - /56-FAM/TTA TTG GCG ATA GCC TGG CGG TGG GTT TTG TTG /3BHQ 1/ - 3' (SEQ ID NO: 14)) complementary to invA gene. A 25-μl reaction mixture containing IX PCR Buffer, 5 mM MgCl₂ (Invitrogen® Life Technologies, CA, USA), 0.4 mM dNTP Mix (Applied Biosystems, CA, USA), 240 nM forward primer, 240 nM reverse primer, 200 nM Taqman probe (Integrated DNA Technologies, Coralville, IA, USA), 2.5 U Platinum® Taq DNA Polymerase (Invitrogen Life Technologies, CA, USA), 2-μg BSA (Promega® Corporation, WI, USA) and 2.5-μl of target DNA was used. Amplification was done in SmartCycler (Cepheid, CA, USA) using a 2-step temperature protocol; after initial denaturation (94 ⁰C for 120 seconds), annealing was performed for 40 cycles of 94 ⁰C for 20 sec and 60 °C for 30 sec. The capture efficiency was estimated based on a standard curve constructed with 10-fold serial dilutions of an overnight culture of 5^*. Typhimurium cells, which were extracted for DNA isolation and subjected to real-time PCR. "CFU equivalent" was calculated for the various dilutions of DNA amplified in real time PCR and corresponded to CFU of the stock culture of Salmonella prior to DNA extraction. The approximate CFU in unknown samples was extrapolated based on resulting Ct values obtained from real-time PCR analysis. Percent capture efficiency was calculated as the ratio of CFU equivalent in real-time PCR/sample divided by the total CFU inoculated/ sample multiplied by 100. Statistical analysis for single factor ANOVA was done in Microsoft-Excel.

RESULTS

SELEX-based enrichment of DNA aptamers and characterization of candidate sequences: The library directed against S. Typhimurium OMP obtained after the seventh round of SELEX was used for further selection and characterization of candidate aptamers. Cloning of this pool resulted in 66 transformants. Nucleotide sequence analysis of all 66 cloned candidates demonstrated that no single aptamer dominated the final pool. When the SELEX pool was exposed to S. Typhimurium OMP, there was a distinct gel shift pattern, indicative of binding, which was absent when the pool was exposed to E. coli, S. Typhimurium LPS or E. coli OMP. Forty-seven individual clones were then screened for reactivity and gel shift on polyacrylamide gels stained with ethidium bromide. Of these, 5 candidates with distinct gel shift in association with S. Typhimurium OMP showed no cross-reactivity with E. coli extracts; the sequences of these aptamers are detailed in Table 1. These five candidates were further screened for sensitivity of binding to 5^*. Typhimurium titers ranging from a high of 10⁹ to a low of 10³ CFU, revealing that aptamers 33 and 45 were able to bind at the lower end of this range. These two aptamers were selected for further analyses. DNA structure analysis using the MFOLD program as applied to these sequences showed common stem loop structures which were likely receptor binding sites.

Table 1: Aptamers candidates after SELEX against Salmonella OMP

South-Western Blot and Mass Spectrometric analysis: South- Western blot reveals that two prominent sets of bands in the Salmonella OMP are recognized by both of the aptamers. Mass spectrometry of the corresponding bands in the gel identified 3 potential protein targets on the Salmonella membrane (Table 2). These membrane proteins included, OmpA, new outer membrane protein OmpD precursor, ABC transporter.

DNAse Footprint assay shows sequence and structure specificity: Sequence-specific binding of the aptamers 33 and 45 to S. Typhimurium was confirmed using a DNase footprint assay (Figures 3 and 4). Both candidate aptamers showed high affinity for S. Typhimurium OMP, whereas the same was not the case using bovine serum albumin (BSA) as a control. Aptamers bound to the OMP with a higher affinity in the randomized region than on the primer regions. Alignment of the panels of the DNase treatment of the aptamer bound to BSA versus that bound to the OMP using GeneMapper® Software suggested that the randomized 40 bp region of the aptamers bound to the S. Typhimurium OMP with a higher affinity when compared to the control protein BSA. DNA structure analysis using the Mfold program as applied to these sequences showed common stem and loop structures which likely served as receptor binding sites. The regions that interact with the protein have been highlighted in red in Figures 3 and 4. Selected aptamers bind to different serovars of Salmonella: Both the aptamers and the aptamer pool were tested for cross reactivity to different serovars of Salmonella at levels of less than 100 CFU in pure culture. Genus-specific real time PCR analysis of the DNA isolated after magnetic capture of pure cultures of these organisms using aptamer-bound beads revealed that the aptamer pool, as well as the candidates 33 and 45, detected all seven Salmonella serotypes screened. SPR analysis: SPR analysis of the kinetics of aptamer binding with the S. Typhimurium

OMP is investigated for aptamer 33 and aptamer 45. Support for preferential binding of S. Typhimurium OMP as compared to others was revealed in the competitive gel shift analysis where in cross reactivity to OMPs of related enterobacteria is abrogated in the presence of S. Typhimurium OMP. Ap tamer-conjugated magnetic bead capture in candidate sample matrices. When aptamer conjugated magnetic beads were used for the capture of S. Typhimurium in pure culture and seeded at low levels into a fecal matrix followed by the application of real-time PCR for detection, the inventors were able to detect 10 CFU per mL pure culture or per g fecal sample (Table 2). Table 2

Treatment invA S. Typhimurium specific fragment

Culture Feces Culture Feces

Aptamer 33 <10 <10 <10 <10

Aptamer 45 <10 <10 <10^a <10

SELEX Pool <10 <10 <10^a <10 a Results of duplicate assays; all others done in triplicate The lower detection limit of aptamer capture in 9-mL of artificially contaminated chicken rinse using the pull-down assay was between 10^1O² CFU (average 1.87 ± 0.92 log₁₀ CFU). The lower detection limit of the magnetic recirculation approach was 10 -10 CFU (average 2.08 ± 1.96 log₁₀ CFU) per 25 ml chicken rinse. Capture efficiency of the aptamer based pull-down assay was calculated as 1.75 ± 0.73% at a contamination level of 10¹ -10² CFU/sample; that for the recirculation assay was 1.45 ± 0.5% at an initial inoculum level of 10 -10 CFU/sample. Significant gradual improvement in capture efficiency of aptamers with smaller numbers of target was observed in both pull-down and recirculation assays (single factor ANOVA, PO.05).

Aptamer-conjugated magnetic bead capture on naturally contaminated field samples. Chicken litter samples confirmed as Salmonella positive (n=3) and negative (n=3) by conventional culture methods were obtained for analysis (Figure 5). Samples were processed for capture using aptamer 33 as described in Laboratory protocol A section. Of the three known Salmonella positive samples, two samples (277 and 286) were positive and all the negative samples were negative by aptamer 33 capture followed by invA PCR analysis. The most probable numbers (MPN) calculated in the surveillance laboratory for the samples 277 and 286 were around 9/gm and for sample 281 (unable to detect using aptamer 33) was 2/gm. This pilot analysis on field samples further confirms that the low-end detection sensitivity was about 10 CFU/gm.

DISCUSSION

Challenges presented for detection of low levels of bacterial contamination in complex sample matrices: Despite a long history of developmental work, the detection of low levels of bacteria in complex sample matrices such as foods and feces is challenging.

Traditional culture-based assays, while considered the "gold-standard," remain time-consuming and laborious. Alternative immunological or molecular assays have been developed and may even be more sensitive than earlier methods. However, preparing the matrix for detection using molecular methods is still problematic. There is a need for sensitive and robust pre-analytical sample processing tools that will facilitate separation and concentration of the target organism for subsequent detection using methods such as PCR. These must reduce sample volumes and remove matrix-associated inhibitors with high recovery of the target. This study produced a candidate technology in the form of nucleic acid aptamers that can specifically capture, concentrate, and in a sense "enrich" S. Typhimurium prior to detection. The studies on "live" naturally infected chicken litter samples confirmed that the selected aptamers would work on complex matrices. As such, this study showed that sensitive and specific pathogen detection was possible without the use of conventional cultural enrichment processes, thus reducing time to detection.

SELEX and aptamers against S. Typhimurium: The SELEX protocol was used to derive aptamers against outer membrane preparations of S. Typhimurium. Since the target OMP preparation contained a mixture of proteins, no single aptamer candidate dominated the final pool and candidates were likely selected against multiple proteins. A similar approach and results were observed when whole membrane preparations from RBC ghosts were used as targets for SELEX. The gel shifts in EMSA experiments clearly demonstrate that there is specific interaction with the protein. In separate experiments, Salmonella OMPs competitively abrogated cross-reactivity to OMPs isolated from other members of the Enterobacteriaceae. This attests to the specificity of the selected aptamers to Salmonella surface proteins. When this was translated to binding of whole cells, these candidates were found to be sensitive enough to detect 10 CFU/gm in spiked fecal samples. Thus SELEX was quite effective at yielding specific candidates that could capture whole bacterial cells, even when a mixed protein target was used in aptamer selection. Potential outer membrane protein targets identified by mass spectrometry after South- Western blot clearly support biochemical interaction for the whole cell capture by this aptamer. While the EMSA demonstrated the affinity of the aptamers to S. Typhimurium in the presence of OMP of similar organisms, the DNase footprint assay offered additional evidence supporting the specificity of the aptamers for S. Typhimurium. The inventors also demonstrated that randomized aptamer regions were highly specific for S. Typhimurium OMP. Because these aptamers were selected for S. Typhimurium OMP in the presence of BSA, it is reasonable to speculate that non-specific aptamer binding to unrelated proteins in a complex sample matrix would be likely abrogated in the presence of S. Typhimurium, a concept consistent with the present findings.

The specificity and sensitivity of the aptamers to other Salmonella serovars were evaluated using pure culture capture. The SELEX "pool" consisting of multiple candidates demonstrated a slightly higher degree of detection sensitivity to all the seven other serovars tested compared with that of aptamers 33 and 45. It is reasonable to expect that multiple serovars would have similar, if not identical protein profiles that share conformations when tested using the SELEX pool, while the individual aptamers would have increased affinity for strain-specific OMP. Overall, there is value in the identification of aptamers with strain specificity (such as for S. Typhimurium) and those with broader reactivity (such as at the genus level), depending on their intended application. More important, aptamers selected in this study have pan-salmonella specificity, which would greatly aid in screening of foods and environmental samples.

Linking bacterial concentration to PCR detection using aptamers for pre-analytical sample processing, hi the past, a direct capture of bacterial cells has been applied, but assay sensitivity is rarely better than 10⁴-10⁵ organisms. Methods using nanotechnology and microelectronics have been developed for rapid detection, but have only been screened on pure cultures and lose sensitivity and specificity when applied to more complex samples.

The present project focused on two important aspects of sample preparation, namely, enrichment (concentration) and purification. The results demonstrate that aptamer-bound beads can be used for pathogen capture in the fecal matrix, followed by PCR for detection. Excellent detection limits of less than 10 CFU/g feces were achieved, suggesting great potential for the practical use of the technology. Aptamer based assays were able to detect a low level of contamination (lO'-lO² CFU/ 9 mL or 10²-10³ CFU/25 ml) as applied to artificially contaminated chicken rinses. The detection limit and capture efficiency observed for both the aptamer-based pull-down and re-circulation assays were almost identical, suggesting that the recirculation assay may be an appropriate alternative when testing samples of larger volume. Further, since the aptamer-based capture protocol targets whole cells, this approach is more likely to detect viable organisms than would be a direct nucleic acid extraction-based method. Although the foregoing specification and examples fully disclose and enable the present invention, they are not intended to limit the scope of the invention, which is defined by the claims appended hereto.

All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention. The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention. Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

WHAT IS CLAIMED IS:

1. A DNA aptamer 10 to 100 bases in length comprising a binding sequence that is at least 95% identical to Aptamer 23 (SEQ ID NO:7), Aptamer 24 (SEQ ID NO:8), Aptamer 25 (SEQ ID NO:9), Aptamer 33 (SEQ ID NO:10) or Aptamer 45 (SEQ ID NO:11).

2. The DNA aptamer of claim 1, wherein the binding sequence is identical to Aptamer 33 or Aptamer 45.

3. The DNA aptamer of claim 1, wherein the binding sequence is 40 bases long.

4. The DNA aptamer of claim 1 , wherein the binding sequence is flanked by a first flanking sequence and a second flanking sequence.

5. The DNA aptamer of claim 4, wherein the first flanking sequence and the second flanking sequence are complementary to form a duplex.

6. The DNA aptamer of claim 4, wherein the first flanking sequence and the second flanking sequence are 1 to 28 bases in length.

7. The DNA aptamer of claim 1, wherein the aptamer is from 40 to 96 bases long.

8. The DNA aptamer of claim 1, wherein the aptamer is 96 bases long.

9. A DNA aptamer consisting of Aptamer 33 (SEQ ID NO:1) or Aptamer 45 (SEQ ID NO:2).

10. A composition comprising a DNA aptamer of any of claim 1 to 9 operably linked to an entity.

11. The composition of claim 10, wherein the entity is a fluorescent tag, affinity tag, a protein, a solid substrate, a cell surface, or a cellular component.

12. The composition of claim 11, wherein the cellular component is a cell wall or cell membrane.

13. The composition of claim 11 , wherein the solid substrate is a component of silica, cellulose, cellulose acetate, nitrocellulose, nylon, polyester, polyethersulfone, polyolefin, or polyvinylidene fluoride, or combinations thereof.

14. The composition of claim 11, wherein the solid substrate is a filter, magnetic bead, metal oxide, latex particle, microtiter plates, polystyrene bead, or CD-ROM.

15. The composition of claim 10, wherein the DNA aptamer is linked to the entity by means of a linker.

16. The composition of claim 15, wherein the linker is a binding pair.

17. The composition of claim 15, wherein a first member of the binding pair comprises avidin or streptavidin and a second member of the binding pair comprises biotin.

18. The composition of claim 10, wherein the DNA aptamer is linked to the entity by means of a covalent bond.

19. A method for detecting Salmonella in a sample comprising contacting the sample with the DNA aptamer of any of claims 1 to 9 or the composition of any of claims 10 to 18 to form bound Salmonella, and detecting the presence or the quantity of bound Salmonella.

20. The method of claim 19, wherein the method is sufficiently sensitive to detect 10-40 organisms/gm of sample.

21. The method of claim 19, wherein the bound Salmonella is detected by means of PCR, nuclear magnetic resonance, fluorescent capillary electrophoresis, lateral flow devices, colorimetry, chemiluminescence, fluorescence, or ELISA.

22. The method of claim 19, wherein the sample is not concentrated or pre-enriched.

23. The method of claim 19, wherein the detection step is completed in less than 6 hours.

24. The method of claim 19, wherein the sample is a physiological sample, a food sample, a liquid sample, or an environmental sample.

25. The method of claim 24, wherein the physiological sample is an animal secretion or excretion.

26. The method of claim 24, wherein the liquid sample is milk, juice, water, carcass wash, or vegetable wash.

27. The method of claim 24, wherein the food sample is a meat sample.

28. The method of claim 19, wherein the method detects whole Salmonella cells.